\
| Variant ID: vg0801822513 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1822513 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGAACAGGAGGAGAAGATTATACCCCGAGAATGGCCCTCCGCTGGATGGTGAGGCAGAATTGCCTCCGTTGTTGTTGTCGTTCACGGCACCTCCTCCTGG[C/T]
GCACTAGCTCCGGCTCCTGTTGGCGGCGCACCACCTCCGCCATCTCCTCCAGCAGCGGCGGCAACTCCAGACATCGCGATGAGCAGTCGTGTGGGAGGCA
TGCCTCCCACACGACTGCTCATCGCGATGTCTGGAGTTGCCGCCGCTGCTGGAGGAGATGGCGGAGGTGGTGCGCCGCCAACAGGAGCCGGAGCTAGTGC[G/A]
CCAGGAGGAGGTGCCGTGAACGACAACAACAACGGAGGCAATTCTGCCTCACCATCCAGCGGAGGGCCATTCTCGGGGTATAATCTTCTCCTCCTGTTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 24.20% | 12.19% | 11.34% | NA |
| All Indica | 2759 | 22.40% | 39.90% | 18.81% | 18.85% | NA |
| All Japonica | 1512 | 98.50% | 1.20% | 0.13% | 0.13% | NA |
| Aus | 269 | 79.90% | 0.40% | 17.47% | 2.23% | NA |
| Indica I | 595 | 31.30% | 64.90% | 2.69% | 1.18% | NA |
| Indica II | 465 | 4.50% | 73.30% | 3.66% | 18.49% | NA |
| Indica III | 913 | 21.70% | 6.60% | 41.18% | 30.56% | NA |
| Indica Intermediate | 786 | 27.20% | 39.90% | 13.99% | 18.83% | NA |
| Temperate Japonica | 767 | 98.30% | 1.60% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.00% | 0.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 23.30% | 8.89% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801822513 | C -> T | LOC_Os08g03810.1 | synonymous_variant ; p.Ala25Ala; LOW | synonymous_codon | Average:59.082; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0801822513 | C -> DEL | LOC_Os08g03810.1 | N | frameshift_variant | Average:59.082; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801822513 | 6.96E-07 | 1.70E-11 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | 7.08E-07 | 1.77E-16 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | NA | 5.91E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | NA | 7.65E-10 | mr1327_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | NA | 5.70E-17 | mr1352_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | NA | 2.88E-06 | mr1483_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | NA | 9.26E-07 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | NA | 9.61E-12 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | 1.11E-06 | 2.99E-11 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | 4.18E-07 | 1.63E-16 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | NA | 1.24E-13 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801822513 | NA | 7.86E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |