Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801799521:

Variant ID: vg0801799521 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1799521
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGGAAAATTTGTGAGTGGAATTGGCGGCGGCAGCGAACCTCGTATCGTGTGCCGCCCCGGCCTCCACCCCTGTTTATATGGCACGGGGTGACGGGGGCC[T/C]
ACCAGCCAATGGGCTGGGCGCCCTCGATCAGGGCGCGGGTCAAGGTCCCCTTGTGCCGTTGGGCTCAAGGGGGAGAGAGATCTATCAAACATCCATTTGT

Reverse complement sequence

ACAAATGGATGTTTGATAGATCTCTCTCCCCCTTGAGCCCAACGGCACAAGGGGACCTTGACCCGCGCCCTGATCGAGGGCGCCCAGCCCATTGGCTGGT[A/G]
GGCCCCCGTCACCCCGTGCCATATAAACAGGGGTGGAGGCCGGGGCGGCACACGATACGAGGTTCGCTGCCGCCGCCAATTCCACTCACAAATTTTCCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.90%	31.80%	0.49%	17.73%	NA
All Indica	2759	48.40%	23.00%	0.65%	27.98%	NA
All Japonica	1512	59.10%	40.70%	0.07%	0.13%	NA
Aus	269	1.10%	78.10%	1.49%	19.33%	NA
Indica I	595	68.40%	28.10%	0.00%	3.53%	NA
Indica II	465	76.80%	14.00%	0.22%	9.03%	NA
Indica III	913	15.20%	22.80%	1.20%	60.79%	NA
Indica Intermediate	786	54.80%	24.80%	0.76%	19.59%	NA
Temperate Japonica	767	97.00%	2.90%	0.13%	0.00%	NA
Tropical Japonica	504	11.10%	88.50%	0.00%	0.40%	NA
Japonica Intermediate	241	39.00%	61.00%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	51.10%	35.60%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801799521	T -> C	LOC_Os08g03770.1	upstream_gene_variant ; 4635.0bp to feature; MODIFIER	silent_mutation	Average:54.559; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0801799521	T -> C	LOC_Os08g03790.1	upstream_gene_variant ; 262.0bp to feature; MODIFIER	silent_mutation	Average:54.559; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0801799521	T -> C	LOC_Os08g03780.1	downstream_gene_variant ; 305.0bp to feature; MODIFIER	silent_mutation	Average:54.559; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0801799521	T -> C	LOC_Os08g03780-LOC_Os08g03790	intergenic_region ; MODIFIER	silent_mutation	Average:54.559; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N
vg0801799521	T -> DEL	N	N	silent_mutation	Average:54.559; most accessible tissue: Zhenshan97 panicle, score: 77.482	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801799521	NA	2.66E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	2.50E-11	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	4.35E-13	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	2.60E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	4.87E-13	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	1.13E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	5.19E-12	9.80E-24	mr1739	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	6.08E-12	5.23E-25	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	1.55E-10	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	4.41E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	6.58E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	3.97E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	1.58E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	3.20E-13	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	5.28E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	7.19E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	1.92E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	1.05E-11	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	2.68E-07	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	9.34E-10	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	2.32E-08	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	7.24E-06	mr1397_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	9.17E-06	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	1.57E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	5.55E-07	mr1483_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	6.88E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	3.87E-16	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	1.00E-05	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	6.02E-06	mr1621_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	9.86E-06	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	3.25E-07	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	1.15E-07	9.37E-23	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	9.70E-19	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	6.79E-17	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	6.19E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	9.34E-09	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	1.76E-09	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	2.59E-10	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801799521	NA	9.59E-07	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251