\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801522955:

Variant ID: vg0801522955 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 1522955
Reference Allele: AAGAlternative Allele: GAG,A
Primary Allele: AAGSecondary Allele: GAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCAAGACGCAGTGTATATGGCAGGTGGGACCATATATTAATAGTGTAGTATGTAACTATTGTATAAATAAGCTATTAAATTGACTATAAATTAATTA[AAG/GAG,A]
CTAGTAGTCAGCTATACTATTGAACTTGCTCTATGAATAAGCTGGCAGAAGAATCTGGAAGCTAGTGGGTTTGTGTGGCTGGGGTATATTCGCTCCCGTG

Reverse complement sequence

CACGGGAGCGAATATACCCCAGCCACACAAACCCACTAGCTTCCAGATTCTTCTGCCAGCTTATTCATAGAGCAAGTTCAATAGTATAGCTGACTACTAG[CTT/CTC,T]
TAATTAATTTATAGTCAATTTAATAGCTTATTTATACAATAGTTACATACTACACTATTAATATATGGTCCCACCTGCCATATACACTGCGTCTTGAAAT

Allele Frequencies:

Populations Population SizeFrequency of AAG(primary allele) Frequency of GAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.00% 19.60% 3.51% 40.96% A: 0.02%
All Indica  2759 6.50% 23.20% 5.69% 64.59% A: 0.04%
All Japonica  1512 97.20% 0.30% 0.13% 2.38% NA
Aus  269 0.40% 93.70% 0.00% 5.95% NA
Indica I  595 4.40% 9.90% 4.71% 81.01% NA
Indica II  465 4.50% 10.30% 2.15% 83.01% NA
Indica III  913 7.20% 35.60% 9.42% 47.75% NA
Indica Intermediate  786 8.40% 26.50% 4.20% 60.81% A: 0.13%
Temperate Japonica  767 96.60% 0.30% 0.00% 3.13% NA
Tropical Japonica  504 98.80% 0.40% 0.00% 0.79% NA
Japonica Intermediate  241 95.90% 0.00% 0.83% 3.32% NA
VI/Aromatic  96 4.20% 9.40% 4.17% 82.29% NA
Intermediate  90 50.00% 21.10% 3.33% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801522955 AAG -> GAG LOC_Os08g03290.1 upstream_gene_variant ; 2340.0bp to feature; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> GAG LOC_Os08g03290.4 upstream_gene_variant ; 2340.0bp to feature; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> GAG LOC_Os08g03290.3 upstream_gene_variant ; 2375.0bp to feature; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> GAG LOC_Os08g03290.2 upstream_gene_variant ; 2481.0bp to feature; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> GAG LOC_Os08g03280.1 downstream_gene_variant ; 1603.0bp to feature; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> GAG LOC_Os08g03280-LOC_Os08g03290 intergenic_region ; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> A LOC_Os08g03290.1 upstream_gene_variant ; 2339.0bp to feature; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> A LOC_Os08g03290.4 upstream_gene_variant ; 2339.0bp to feature; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> A LOC_Os08g03290.3 upstream_gene_variant ; 2374.0bp to feature; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> A LOC_Os08g03290.2 upstream_gene_variant ; 2480.0bp to feature; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> A LOC_Os08g03280.1 downstream_gene_variant ; 1604.0bp to feature; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> A LOC_Os08g03280-LOC_Os08g03290 intergenic_region ; MODIFIER silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N
vg0801522955 AAG -> DEL N N silent_mutation Average:98.302; most accessible tissue: Callus, score: 99.196 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0801522955 AAG A -0.25 -0.15 -0.04 0.12 -0.01 -0.05
vg0801522955 AAG GAG -0.01 -0.03 -0.01 0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801522955 NA 1.72E-11 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801522955 NA 5.34E-06 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801522955 NA 3.49E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801522955 NA 2.17E-09 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801522955 NA 6.62E-13 mr1741 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801522955 NA 3.31E-15 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801522955 NA 8.76E-16 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801522955 NA 9.93E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251