\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801511665:

Variant ID: vg0801511665 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1511665
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAAGACGCACTGCGAGTTCCCGGCCATCGCGCGGAGCACGCCAAGGGACAACTTCGCCGTTCTCCTCCACGTCAAGGCTCCTAGCATCGCCGCGGAGG[C/A]
GGCGCCGGCGCGCGCGTCGGTCGACCTCGTCACGGTGCTCGACGTGAGCGGCAGCATGGAAGGCTACAAGCTCGCGCTACTGAAGCGCGCCATGGGGTTG

Reverse complement sequence

CAACCCCATGGCGCGCTTCAGTAGCGCGAGCTTGTAGCCTTCCATGCTGCCGCTCACGTCGAGCACCGTGACGAGGTCGACCGACGCGCGCGCCGGCGCC[G/T]
CCTCCGCGGCGATGCTAGGAGCCTTGACGTGGAGGAGAACGGCGAAGTTGTCCCTTGGCGTGCTCCGCGCGATGGCCGGGAACTCGCAGTGCGTCTTGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 0.30% 5.63% 15.32% NA
All Indica  2759 65.00% 0.50% 9.39% 25.19% NA
All Japonica  1512 98.50% 0.10% 0.26% 1.12% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 46.20% 0.70% 11.60% 41.51% NA
Indica II  465 35.70% 1.10% 20.43% 42.80% NA
Indica III  913 91.10% 0.10% 2.52% 6.24% NA
Indica Intermediate  786 66.00% 0.40% 9.16% 24.43% NA
Temperate Japonica  767 97.80% 0.10% 0.52% 1.56% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 85.60% 0.00% 2.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801511665 C -> A LOC_Os08g03260.1 missense_variant ; p.Ala235Glu; MODERATE nonsynonymous_codon ; A235E Average:72.923; most accessible tissue: Zhenshan97 root, score: 83.751 unknown unknown TOLERATED 0.05
vg0801511665 C -> DEL LOC_Os08g03260.1 N frameshift_variant Average:72.923; most accessible tissue: Zhenshan97 root, score: 83.751 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801511665 NA 7.22E-08 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801511665 NA 1.28E-06 mr1279 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801511665 NA 5.02E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801511665 4.13E-07 1.33E-12 mr1216_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801511665 1.34E-06 4.05E-10 mr1216_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801511665 NA 2.29E-07 mr1472_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801511665 NA 1.22E-06 mr1483_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801511665 NA 9.25E-08 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801511665 NA 9.73E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801511665 NA 1.05E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801511665 NA 3.36E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251