\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801480069:

Variant ID: vg0801480069 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1480069
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, C: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AACGCAAGCCAGCGACTCCACTGTGAAGGACAGGCATGGACAAAACAACGGAGGAATGTCTCTAGGCATTTATTCACACGTTCAGTCTGGCCGTCAGTCT[G/A,C]
AGGATGGTAAGAGGAACTCATTCGGAGTTGAGTGCCGGCTAACTTGAATAGAGTAGTCCACAATGTACTAGTGAAAATGCGATCACGGTCAGAAATCAAA

Reverse complement sequence

TTTGATTTCTGACCGTGATCGCATTTTCACTAGTACATTGTGGACTACTCTATTCAAGTTAGCCGGCACTCAACTCCGAATGAGTTCCTCTTACCATCCT[C/T,G]
AGACTGACGGCCAGACTGAACGTGTGAATAAATGCCTAGAGACATTCCTCCGTTGTTTTGTCCATGCCTGTCCTTCACAGTGGAGTCGCTGGCTTGCGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 12.80% 6.60% 22.26% C: 0.30%
All Indica  2759 47.20% 9.90% 7.43% 35.09% C: 0.40%
All Japonica  1512 76.70% 18.50% 3.17% 1.59% C: 0.13%
Aus  269 81.40% 1.50% 13.01% 4.09% NA
Indica I  595 35.60% 6.90% 10.59% 46.39% C: 0.50%
Indica II  465 18.10% 18.10% 10.75% 53.12% NA
Indica III  913 71.10% 8.30% 3.94% 16.43% C: 0.22%
Indica Intermediate  786 45.30% 9.30% 7.12% 37.53% C: 0.76%
Temperate Japonica  767 92.70% 1.40% 3.65% 1.96% C: 0.26%
Tropical Japonica  504 49.20% 47.60% 2.58% 0.60% NA
Japonica Intermediate  241 83.00% 11.60% 2.90% 2.49% NA
VI/Aromatic  96 17.70% 29.20% 17.71% 35.42% NA
Intermediate  90 53.30% 21.10% 7.78% 16.67% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801480069 G -> C LOC_Os08g03200.1 intron_variant ; MODIFIER silent_mutation Average:11.994; most accessible tissue: Callus, score: 38.568 N N N N
vg0801480069 G -> A LOC_Os08g03200.1 intron_variant ; MODIFIER silent_mutation Average:11.994; most accessible tissue: Callus, score: 38.568 N N N N
vg0801480069 G -> DEL N N silent_mutation Average:11.994; most accessible tissue: Callus, score: 38.568 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801480069 3.09E-11 1.46E-27 mr1301 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 4.23E-06 2.59E-18 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 2.69E-08 5.51E-21 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 4.99E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 2.62E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 2.57E-12 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 1.35E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 6.02E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 1.19E-06 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 1.40E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 3.32E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 6.27E-09 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 2.95E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 9.53E-10 4.44E-27 mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 5.49E-06 1.26E-19 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 2.02E-07 2.59E-20 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 5.06E-15 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 1.05E-06 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 3.58E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 3.07E-13 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 1.52E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801480069 NA 1.06E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251