| Variant ID: vg0801474449 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1474449 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, C: 0.45, others allele: 0.00, population size: 85. )
GGAGTAAGTATAAAATTTAGCTGCTCCTCTTACTTGATCAAATATCCAAAGAAAGAAGATCTAAAATCTTGATGGTATTTTGCATAGTTGACTAGGGCTA[G/C]
GTTCGGGAGGTGGAGTTCCACGGAAAATGGGGTTGTATTCCATTAACACGTGATTAATTAAATATTAGTCTTAAAAACTTGAAAAATGAATTAATATAAT
ATTATATTAATTCATTTTTCAAGTTTTTAAGACTAATATTTAATTAATCACGTGTTAATGGAATACAACCCCATTTTCCGTGGAACTCCACCTCCCGAAC[C/G]
TAGCCCTAGTCAACTATGCAAAATACCATCAAGATTTTAGATCTTCTTTCTTTGGATATTTGATCAAGTAAGAGGAGCAGCTAAATTTTATACTTACTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.00% | 28.20% | 0.47% | 32.35% | NA |
| All Indica | 2759 | 11.10% | 38.70% | 0.69% | 49.51% | NA |
| All Japonica | 1512 | 97.40% | 0.50% | 0.00% | 2.05% | NA |
| Aus | 269 | 1.90% | 84.00% | 0.00% | 14.13% | NA |
| Indica I | 595 | 3.70% | 35.10% | 0.50% | 60.67% | NA |
| Indica II | 465 | 7.70% | 11.00% | 0.65% | 80.65% | NA |
| Indica III | 913 | 16.80% | 57.40% | 0.44% | 25.41% | NA |
| Indica Intermediate | 786 | 12.00% | 36.30% | 1.15% | 50.64% | NA |
| Temperate Japonica | 767 | 96.70% | 0.40% | 0.00% | 2.87% | NA |
| Tropical Japonica | 504 | 98.80% | 0.60% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.80% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 8.30% | 11.50% | 3.12% | 77.08% | NA |
| Intermediate | 90 | 56.70% | 21.10% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801474449 | G -> C | LOC_Os08g03190.1 | upstream_gene_variant ; 729.0bp to feature; MODIFIER | silent_mutation | Average:12.434; most accessible tissue: Callus, score: 68.211 | N | N | N | N |
| vg0801474449 | G -> C | LOC_Os08g03180.1 | downstream_gene_variant ; 1219.0bp to feature; MODIFIER | silent_mutation | Average:12.434; most accessible tissue: Callus, score: 68.211 | N | N | N | N |
| vg0801474449 | G -> C | LOC_Os08g03200.1 | downstream_gene_variant ; 3089.0bp to feature; MODIFIER | silent_mutation | Average:12.434; most accessible tissue: Callus, score: 68.211 | N | N | N | N |
| vg0801474449 | G -> C | LOC_Os08g03190-LOC_Os08g03200 | intergenic_region ; MODIFIER | silent_mutation | Average:12.434; most accessible tissue: Callus, score: 68.211 | N | N | N | N |
| vg0801474449 | G -> DEL | N | N | silent_mutation | Average:12.434; most accessible tissue: Callus, score: 68.211 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801474449 | NA | 2.50E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801474449 | 2.55E-06 | NA | mr1245 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801474449 | NA | 5.72E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801474449 | 5.67E-06 | NA | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801474449 | NA | 6.91E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801474449 | 2.43E-06 | NA | mr1652 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801474449 | NA | 9.63E-06 | mr1758 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801474449 | NA | 5.96E-06 | mr1838 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801474449 | NA | 1.70E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |