Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0801474449:

Variant ID: vg0801474449 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1474449
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, C: 0.45, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGTAAGTATAAAATTTAGCTGCTCCTCTTACTTGATCAAATATCCAAAGAAAGAAGATCTAAAATCTTGATGGTATTTTGCATAGTTGACTAGGGCTA[G/C]
GTTCGGGAGGTGGAGTTCCACGGAAAATGGGGTTGTATTCCATTAACACGTGATTAATTAAATATTAGTCTTAAAAACTTGAAAAATGAATTAATATAAT

Reverse complement sequence

ATTATATTAATTCATTTTTCAAGTTTTTAAGACTAATATTTAATTAATCACGTGTTAATGGAATACAACCCCATTTTCCGTGGAACTCCACCTCCCGAAC[C/G]
TAGCCCTAGTCAACTATGCAAAATACCATCAAGATTTTAGATCTTCTTTCTTTGGATATTTGATCAAGTAAGAGGAGCAGCTAAATTTTATACTTACTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	28.20%	0.47%	32.35%	NA
All Indica	2759	11.10%	38.70%	0.69%	49.51%	NA
All Japonica	1512	97.40%	0.50%	0.00%	2.05%	NA
Aus	269	1.90%	84.00%	0.00%	14.13%	NA
Indica I	595	3.70%	35.10%	0.50%	60.67%	NA
Indica II	465	7.70%	11.00%	0.65%	80.65%	NA
Indica III	913	16.80%	57.40%	0.44%	25.41%	NA
Indica Intermediate	786	12.00%	36.30%	1.15%	50.64%	NA
Temperate Japonica	767	96.70%	0.40%	0.00%	2.87%	NA
Tropical Japonica	504	98.80%	0.60%	0.00%	0.60%	NA
Japonica Intermediate	241	96.70%	0.80%	0.00%	2.49%	NA
VI/Aromatic	96	8.30%	11.50%	3.12%	77.08%	NA
Intermediate	90	56.70%	21.10%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801474449	G -> C	LOC_Os08g03190.1	upstream_gene_variant ; 729.0bp to feature; MODIFIER	silent_mutation	Average:12.434; most accessible tissue: Callus, score: 68.211	N	N	N	N
vg0801474449	G -> C	LOC_Os08g03180.1	downstream_gene_variant ; 1219.0bp to feature; MODIFIER	silent_mutation	Average:12.434; most accessible tissue: Callus, score: 68.211	N	N	N	N
vg0801474449	G -> C	LOC_Os08g03200.1	downstream_gene_variant ; 3089.0bp to feature; MODIFIER	silent_mutation	Average:12.434; most accessible tissue: Callus, score: 68.211	N	N	N	N
vg0801474449	G -> C	LOC_Os08g03190-LOC_Os08g03200	intergenic_region ; MODIFIER	silent_mutation	Average:12.434; most accessible tissue: Callus, score: 68.211	N	N	N	N
vg0801474449	G -> DEL	N	N	silent_mutation	Average:12.434; most accessible tissue: Callus, score: 68.211	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801474449	NA	2.50E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801474449	2.55E-06	NA	mr1245	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801474449	NA	5.72E-10	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801474449	5.67E-06	NA	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801474449	NA	6.91E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801474449	2.43E-06	NA	mr1652	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801474449	NA	9.63E-06	mr1758	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801474449	NA	5.96E-06	mr1838	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801474449	NA	1.70E-15	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251