Variant ID: vg0801451645 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 1451645 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGAGGAGATGAGGTAGCCCGGTCGATGACTAGGCGCAAGCTAGCGCATCTAAAAGTTATCCTATGCTTATTCACACAGTTGTTTAGTTATTTATGTAGTT[T/C]
ATAAACTCCTTATATAAGGTACTGGAATTTCTGTGGGATAGTAAATGAGATCTCCGCCTATGGTGTTCTTCTAGTGTTTGAACAGGTGCACTCACGAGGA
TCCTCGTGAGTGCACCTGTTCAAACACTAGAAGAACACCATAGGCGGAGATCTCATTTACTATCCCACAGAAATTCCAGTACCTTATATAAGGAGTTTAT[A/G]
AACTACATAAATAACTAAACAACTGTGTGAATAAGCATAGGATAACTTTTAGATGCGCTAGCTTGCGCCTAGTCATCGACCGGGCTACCTCATCTCCTCT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 79.10% | 20.80% | 0.15% | 0.00% | NA |
All Indica | 2759 | 68.00% | 31.90% | 0.14% | 0.00% | NA |
All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 73.80% | 26.10% | 0.17% | 0.00% | NA |
Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 43.50% | 56.30% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 75.80% | 24.00% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 17.70% | 79.20% | 3.12% | 0.00% | NA |
Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0801451645 | T -> C | LOC_Os08g03150.1 | upstream_gene_variant ; 1151.0bp to feature; MODIFIER | silent_mutation | Average:70.331; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
vg0801451645 | T -> C | LOC_Os08g03160.1 | downstream_gene_variant ; 2511.0bp to feature; MODIFIER | silent_mutation | Average:70.331; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
vg0801451645 | T -> C | LOC_Os08g03150-LOC_Os08g03160 | intergenic_region ; MODIFIER | silent_mutation | Average:70.331; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0801451645 | NA | 9.76E-07 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0801451645 | 2.39E-07 | 1.28E-20 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0801451645 | 2.70E-07 | 1.52E-18 | mr1739 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0801451645 | NA | 2.53E-07 | mr1758 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0801451645 | NA | 2.31E-15 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0801451645 | NA | 2.04E-13 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |