Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0801447167:

Variant ID: vg0801447167 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1447167
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGATCAAATAGAAACTTGCATGTTTGTGTACAGACTTATATCATCACAATTGATGTTACTAATTTTTTTATTTTTTTTCAATAACTATTTAAGTCGCAC[A/T]
TAAATGTTGGGTGTCATGACACCTAGGTACAGAGAATCCTAATCTCTTTATTGTACCCTTCCTTTTTTTGCTTTGAAACTACACTTTAAGACTTTGTTCT

Reverse complement sequence

AGAACAAAGTCTTAAAGTGTAGTTTCAAAGCAAAAAAAGGAAGGGTACAATAAAGAGATTAGGATTCTCTGTACCTAGGTGTCATGACACCCAACATTTA[T/A]
GTGCGACTTAAATAGTTATTGAAAAAAAATAAAAAAATTAGTAACATCAATTGTGATGATATAAGTCTGTACACAAACATGCAAGTTTCTATTTGATCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.00%	1.10%	0.23%	53.66%	NA
All Indica	2759	19.60%	1.70%	0.33%	78.29%	NA
All Japonica	1512	97.60%	0.00%	0.07%	2.31%	NA
Aus	269	16.40%	0.00%	0.00%	83.64%	NA
Indica I	595	12.40%	4.50%	0.84%	82.18%	NA
Indica II	465	16.30%	0.00%	0.43%	83.23%	NA
Indica III	913	25.70%	0.50%	0.00%	73.71%	NA
Indica Intermediate	786	20.00%	2.00%	0.25%	77.74%	NA
Temperate Japonica	767	97.10%	0.00%	0.13%	2.74%	NA
Tropical Japonica	504	99.20%	0.00%	0.00%	0.79%	NA
Japonica Intermediate	241	95.90%	0.00%	0.00%	4.15%	NA
VI/Aromatic	96	11.50%	1.00%	1.04%	86.46%	NA
Intermediate	90	62.20%	1.10%	0.00%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801447167	A -> T	LOC_Os08g03150.1	downstream_gene_variant ; 86.0bp to feature; MODIFIER	silent_mutation	Average:10.367; most accessible tissue: Callus, score: 57.023	N	N	N	N
vg0801447167	A -> T	LOC_Os08g03140-LOC_Os08g03150	intergenic_region ; MODIFIER	silent_mutation	Average:10.367; most accessible tissue: Callus, score: 57.023	N	N	N	N
vg0801447167	A -> DEL	N	N	silent_mutation	Average:10.367; most accessible tissue: Callus, score: 57.023	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801447167	NA	1.22E-06	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	5.53E-06	4.75E-13	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	1.96E-06	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	1.34E-06	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	3.05E-06	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	3.67E-13	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	4.00E-06	6.18E-18	mr1739	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	1.35E-07	mr1758	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	1.37E-11	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	2.80E-07	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	4.97E-15	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	2.54E-13	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	1.30E-14	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	1.47E-08	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801447167	NA	1.04E-06	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251