\
| Variant ID: vg0801447167 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1447167 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGATCAAATAGAAACTTGCATGTTTGTGTACAGACTTATATCATCACAATTGATGTTACTAATTTTTTTATTTTTTTTCAATAACTATTTAAGTCGCAC[A/T]
TAAATGTTGGGTGTCATGACACCTAGGTACAGAGAATCCTAATCTCTTTATTGTACCCTTCCTTTTTTTGCTTTGAAACTACACTTTAAGACTTTGTTCT
AGAACAAAGTCTTAAAGTGTAGTTTCAAAGCAAAAAAAGGAAGGGTACAATAAAGAGATTAGGATTCTCTGTACCTAGGTGTCATGACACCCAACATTTA[T/A]
GTGCGACTTAAATAGTTATTGAAAAAAAATAAAAAAATTAGTAACATCAATTGTGATGATATAAGTCTGTACACAAACATGCAAGTTTCTATTTGATCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.00% | 1.10% | 0.23% | 53.66% | NA |
| All Indica | 2759 | 19.60% | 1.70% | 0.33% | 78.29% | NA |
| All Japonica | 1512 | 97.60% | 0.00% | 0.07% | 2.31% | NA |
| Aus | 269 | 16.40% | 0.00% | 0.00% | 83.64% | NA |
| Indica I | 595 | 12.40% | 4.50% | 0.84% | 82.18% | NA |
| Indica II | 465 | 16.30% | 0.00% | 0.43% | 83.23% | NA |
| Indica III | 913 | 25.70% | 0.50% | 0.00% | 73.71% | NA |
| Indica Intermediate | 786 | 20.00% | 2.00% | 0.25% | 77.74% | NA |
| Temperate Japonica | 767 | 97.10% | 0.00% | 0.13% | 2.74% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.00% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 11.50% | 1.00% | 1.04% | 86.46% | NA |
| Intermediate | 90 | 62.20% | 1.10% | 0.00% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801447167 | A -> T | LOC_Os08g03150.1 | downstream_gene_variant ; 86.0bp to feature; MODIFIER | silent_mutation | Average:10.367; most accessible tissue: Callus, score: 57.023 | N | N | N | N |
| vg0801447167 | A -> T | LOC_Os08g03140-LOC_Os08g03150 | intergenic_region ; MODIFIER | silent_mutation | Average:10.367; most accessible tissue: Callus, score: 57.023 | N | N | N | N |
| vg0801447167 | A -> DEL | N | N | silent_mutation | Average:10.367; most accessible tissue: Callus, score: 57.023 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801447167 | NA | 1.22E-06 | mr1274 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | 5.53E-06 | 4.75E-13 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 1.96E-06 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 1.34E-06 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 3.05E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 3.67E-13 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | 4.00E-06 | 6.18E-18 | mr1739 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 1.35E-07 | mr1758 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 1.37E-11 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 2.80E-07 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 4.97E-15 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 2.54E-13 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 1.30E-14 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 1.47E-08 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801447167 | NA | 1.04E-06 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |