\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801340528:

Variant ID: vg0801340528 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1340528
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTTTCAAATTTTGGCTTGATCACTCTGTGAAGTAGCAGAGATGTCAATCTTGGACGATATGCTTGCTGCATGAATCTCTTATGTCTTAAATCTGACA[A/T]
TTGGCTGTTGTTATTTTTGTGTGTTAACAATTTTGCTTCGATGTTCTCGATTCAGCGTTCAATCAACACCGGTGTATGTACTGAACATAAATATCCACAA

Reverse complement sequence

TTGTGGATATTTATGTTCAGTACATACACCGGTGTTGATTGAACGCTGAATCGAGAACATCGAAGCAAAATTGTTAACACACAAAAATAACAACAGCCAA[T/A]
TGTCAGATTTAAGACATAAGAGATTCATGCAGCAAGCATATCGTCCAAGATTGACATCTCTGCTACTTCACAGAGTGATCAAGCCAAAATTTGAAAGAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 19.10% 1.18% 26.22% NA
All Indica  2759 32.30% 23.80% 1.81% 42.15% NA
All Japonica  1512 98.00% 0.40% 0.00% 1.59% NA
Aus  269 3.70% 82.90% 0.74% 12.64% NA
Indica I  595 29.90% 25.40% 1.18% 43.53% NA
Indica II  465 21.50% 2.40% 2.58% 73.55% NA
Indica III  913 37.20% 37.90% 1.53% 23.33% NA
Indica Intermediate  786 34.60% 18.80% 2.16% 44.40% NA
Temperate Japonica  767 97.30% 0.30% 0.00% 2.48% NA
Tropical Japonica  504 99.00% 0.60% 0.00% 0.40% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 91.70% 2.10% 2.08% 4.17% NA
Intermediate  90 64.40% 17.80% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801340528 A -> T LOC_Os08g03020.1 downstream_gene_variant ; 260.0bp to feature; MODIFIER silent_mutation Average:10.258; most accessible tissue: Callus, score: 42.009 N N N N
vg0801340528 A -> T LOC_Os08g03010-LOC_Os08g03020 intergenic_region ; MODIFIER silent_mutation Average:10.258; most accessible tissue: Callus, score: 42.009 N N N N
vg0801340528 A -> DEL N N silent_mutation Average:10.258; most accessible tissue: Callus, score: 42.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801340528 1.07E-06 1.37E-13 mr1277 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801340528 NA 1.32E-07 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801340528 NA 1.20E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801340528 NA 5.07E-14 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801340528 NA 3.20E-07 mr1758 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801340528 NA 2.65E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801340528 NA 6.29E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801340528 NA 7.84E-06 mr1559_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801340528 NA 9.65E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801340528 NA 1.39E-11 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251