\
| Variant ID: vg0801340528 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1340528 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 195. )
TCTCTTTCAAATTTTGGCTTGATCACTCTGTGAAGTAGCAGAGATGTCAATCTTGGACGATATGCTTGCTGCATGAATCTCTTATGTCTTAAATCTGACA[A/T]
TTGGCTGTTGTTATTTTTGTGTGTTAACAATTTTGCTTCGATGTTCTCGATTCAGCGTTCAATCAACACCGGTGTATGTACTGAACATAAATATCCACAA
TTGTGGATATTTATGTTCAGTACATACACCGGTGTTGATTGAACGCTGAATCGAGAACATCGAAGCAAAATTGTTAACACACAAAAATAACAACAGCCAA[T/A]
TGTCAGATTTAAGACATAAGAGATTCATGCAGCAAGCATATCGTCCAAGATTGACATCTCTGCTACTTCACAGAGTGATCAAGCCAAAATTTGAAAGAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 19.10% | 1.18% | 26.22% | NA |
| All Indica | 2759 | 32.30% | 23.80% | 1.81% | 42.15% | NA |
| All Japonica | 1512 | 98.00% | 0.40% | 0.00% | 1.59% | NA |
| Aus | 269 | 3.70% | 82.90% | 0.74% | 12.64% | NA |
| Indica I | 595 | 29.90% | 25.40% | 1.18% | 43.53% | NA |
| Indica II | 465 | 21.50% | 2.40% | 2.58% | 73.55% | NA |
| Indica III | 913 | 37.20% | 37.90% | 1.53% | 23.33% | NA |
| Indica Intermediate | 786 | 34.60% | 18.80% | 2.16% | 44.40% | NA |
| Temperate Japonica | 767 | 97.30% | 0.30% | 0.00% | 2.48% | NA |
| Tropical Japonica | 504 | 99.00% | 0.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 91.70% | 2.10% | 2.08% | 4.17% | NA |
| Intermediate | 90 | 64.40% | 17.80% | 2.22% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801340528 | A -> T | LOC_Os08g03020.1 | downstream_gene_variant ; 260.0bp to feature; MODIFIER | silent_mutation | Average:10.258; most accessible tissue: Callus, score: 42.009 | N | N | N | N |
| vg0801340528 | A -> T | LOC_Os08g03010-LOC_Os08g03020 | intergenic_region ; MODIFIER | silent_mutation | Average:10.258; most accessible tissue: Callus, score: 42.009 | N | N | N | N |
| vg0801340528 | A -> DEL | N | N | silent_mutation | Average:10.258; most accessible tissue: Callus, score: 42.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801340528 | 1.07E-06 | 1.37E-13 | mr1277 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801340528 | NA | 1.32E-07 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801340528 | NA | 1.20E-09 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801340528 | NA | 5.07E-14 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801340528 | NA | 3.20E-07 | mr1758 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801340528 | NA | 2.65E-07 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801340528 | NA | 6.29E-07 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801340528 | NA | 7.84E-06 | mr1559_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801340528 | NA | 9.65E-11 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801340528 | NA | 1.39E-11 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |