\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801311224:

Variant ID: vg0801311224 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1311224
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCGCGTTCGGATCAGGGTGTGCGCACCAGAGCCCGATGACAATGACACGCTCCATCTCCGCCGCGTCGTAGTCGCCGTTGAGCCGCTCATCAGCGGCC[A/G]
TGAGAATGTCTCCCTTGCCGTACAAATCCCAAGCCCACTCGACCAACCGGAAGATACCATTCTTCTGGCTGTCTAGTAAGCTCATCGGCCTCCTCCCGCA

Reverse complement sequence

TGCGGGAGGAGGCCGATGAGCTTACTAGACAGCCAGAAGAATGGTATCTTCCGGTTGGTCGAGTGGGCTTGGGATTTGTACGGCAAGGGAGACATTCTCA[T/C]
GGCCGCTGATGAGCGGCTCAACGGCGACTACGACGCGGCGGAGATGGAGCGTGTCATTGTCATCGGGCTCTGGTGCGCACACCCTGATCCGAACGCGCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 24.00% 0.19% 1.02% NA
All Indica  2759 69.20% 28.70% 0.33% 1.74% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 72.60% 27.20% 0.17% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 49.10% 46.30% 0.55% 4.05% NA
Indica Intermediate  786 73.80% 24.40% 0.38% 1.40% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801311224 A -> G LOC_Os08g02996.1 missense_variant ; p.Met629Thr; MODERATE nonsynonymous_codon ; M629T Average:76.967; most accessible tissue: Zhenshan97 young leaf, score: 88.127 benign -0.081 TOLERATED 0.15
vg0801311224 A -> G LOC_Os08g02996.2 missense_variant ; p.Met629Thr; MODERATE nonsynonymous_codon ; M629T Average:76.967; most accessible tissue: Zhenshan97 young leaf, score: 88.127 benign -0.114 TOLERATED 0.14
vg0801311224 A -> DEL LOC_Os08g02996.2 N frameshift_variant Average:76.967; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0801311224 A -> DEL LOC_Os08g02996.1 N frameshift_variant Average:76.967; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801311224 NA 3.34E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801311224 5.24E-07 4.21E-13 mr1277 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801311224 NA 2.71E-07 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801311224 NA 6.60E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801311224 NA 1.08E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801311224 NA 5.05E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801311224 NA 1.25E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801311224 NA 5.60E-10 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801311224 NA 8.74E-08 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251