Search for Variation information by Variation ID:
Detailed information for vg0801311224:
| Variant ID: vg0801311224 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1311224 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 191. )
Flanking Sequence (100 bp) in Reference Genome:
ACGCGCGTTCGGATCAGGGTGTGCGCACCAGAGCCCGATGACAATGACACGCTCCATCTCCGCCGCGTCGTAGTCGCCGTTGAGCCGCTCATCAGCGGCC[A/G]
TGAGAATGTCTCCCTTGCCGTACAAATCCCAAGCCCACTCGACCAACCGGAAGATACCATTCTTCTGGCTGTCTAGTAAGCTCATCGGCCTCCTCCCGCA
Reverse complement sequence
TGCGGGAGGAGGCCGATGAGCTTACTAGACAGCCAGAAGAATGGTATCTTCCGGTTGGTCGAGTGGGCTTGGGATTTGTACGGCAAGGGAGACATTCTCA[T/C]
GGCCGCTGATGAGCGGCTCAACGGCGACTACGACGCGGCGGAGATGGAGCGTGTCATTGTCATCGGGCTCTGGTGCGCACACCCTGATCCGAACGCGCGT
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.80% | 24.00% | 0.19% | 1.02% | NA |
| All Indica | 2759 | 69.20% | 28.70% | 0.33% | 1.74% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 72.60% | 27.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 49.10% | 46.30% | 0.55% | 4.05% | NA |
| Indica Intermediate | 786 | 73.80% | 24.40% | 0.38% | 1.40% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801311224 | A -> G | LOC_Os08g02996.1 | missense_variant ; p.Met629Thr; MODERATE | nonsynonymous_codon ; M629T | Average:76.967; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | benign  |
-0.081 |
TOLERATED | 0.15 |
| vg0801311224 | A -> G | LOC_Os08g02996.2 | missense_variant ; p.Met629Thr; MODERATE | nonsynonymous_codon ; M629T | Average:76.967; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | benign |
-0.114 |
TOLERATED | 0.14 |
| vg0801311224 | A -> DEL | LOC_Os08g02996.2 | N | frameshift_variant | Average:76.967; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| vg0801311224 | A -> DEL | LOC_Os08g02996.1 | N | frameshift_variant | Average:76.967; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801311224 | NA | 3.34E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801311224 | 5.24E-07 | 4.21E-13 | mr1277 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801311224 | NA | 2.71E-07 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801311224 | NA | 6.60E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801311224 | NA | 1.08E-08 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801311224 | NA | 5.05E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801311224 | NA | 1.25E-14 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801311224 | NA | 5.60E-10 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801311224 | NA | 8.74E-08 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |