Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0800643128:

Variant ID: vg0800643128 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 643128
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 390. )

Flanking Sequence (100 bp) in Reference Genome:

GTAGGGCCATATTGTCCACTCGGAATGAGTTCGTCGATCGAATAAACATGAAGATGATTGAGCGGTTTAGAGGGGATGTGATGACATATCATAGTTTTGA[T/C]
TGAGTAGAGGATGACCCTCATAACTATTACCCGCCAGAATTCTTGAACTCTCTAACTCCAAATGGGCTACCTCCGCATGTGCTTAAGCTGAAGATAAACT

Reverse complement sequence

AGTTTATCTTCAGCTTAAGCACATGCGGAGGTAGCCCATTTGGAGTTAGAGAGTTCAAGAATTCTGGCGGGTAATAGTTATGAGGGTCATCCTCTACTCA[A/G]
TCAAAACTATGATATGTCATCACATCCCCTCTAAACCGCTCAATCATCTTCATGTTTATTCGATCGACGAACTCATTCCGAGTGGACAATATGGCCCTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	8.90%	1.54%	0.00%	NA
All Indica	2759	99.50%	0.30%	0.29%	0.00%	NA
All Japonica	1512	69.00%	26.90%	4.10%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.20%	0.30%	0.50%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.40%	0.10%	0.51%	0.00%	NA
Temperate Japonica	767	46.00%	48.10%	5.87%	0.00%	NA
Tropical Japonica	504	97.40%	1.40%	1.19%	0.00%	NA
Japonica Intermediate	241	83.00%	12.40%	4.56%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	10.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800643128	T -> C	LOC_Os08g02000.1	intron_variant ; MODIFIER	silent_mutation	Average:41.098; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800643128	NA	2.89E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	6.42E-08	mr1443	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	1.56E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	8.55E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	2.69E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	3.24E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	5.20E-06	mr1446_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	3.73E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	3.91E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	5.75E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	9.56E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	5.77E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	3.97E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	2.23E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800643128	NA	1.49E-07	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251