\
| Variant ID: vg0800517477 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 517477 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, C: 0.08, others allele: 0.00, population size: 227. )
CCTTTGGATATGAGCATGTAATATATTACCAATATTTCCAGTAGCCGGTGCTTCTTTATTAACAAAAAAGGATCAATTCTTAAAGGAAAAACATGATACT[G/C]
GCAGGCTATCCAGCAGCTTTCTGAATTTTTTTTGTCAGTTCTCAACGCCCTCCCAACTTAGCAGAATTTTCCCCCAAAGTATCTATTGGTGTTGGCCTAT
ATAGGCCAACACCAATAGATACTTTGGGGGAAAATTCTGCTAAGTTGGGAGGGCGTTGAGAACTGACAAAAAAAATTCAGAAAGCTGCTGGATAGCCTGC[C/G]
AGTATCATGTTTTTCCTTTAAGAATTGATCCTTTTTTGTTAATAAAGAAGCACCGGCTACTGGAAATATTGGTAATATATTACATGCTCATATCCAAAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.60% | 15.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 84.90% | 15.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 25.70% | 74.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.40% | 17.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 61.90% | 38.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800517477 | G -> C | LOC_Os08g01850.1 | downstream_gene_variant ; 2181.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800517477 | G -> C | LOC_Os08g01840.1 | intron_variant ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800517477 | NA | 5.02E-11 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 2.65E-10 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 1.67E-10 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 4.54E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 1.55E-08 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 5.64E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 5.57E-16 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 1.12E-08 | mr1800 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 3.57E-09 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 9.81E-08 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 1.02E-11 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 1.40E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 7.44E-08 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 1.99E-14 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800517477 | NA | 9.43E-10 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |