\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800452335:

Variant ID: vg0800452335 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 452335
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAATGAGCTAAGGTGATTCTTCCTGTGCCTTCTCTAACATTTCTTTTTTCATTCATTTCCTCATCTTTTCTATGCTCCTTTACAGTTTCAACTTGTGG[G/A]
TACTCGTATATATTTATTTAACTTAAGGAAATATTAACAGGTACAAGAAACTTTTGGCTAGTGTTGATCTCACCAAGGATTTCTTCTATAGCTACACATA

Reverse complement sequence

TATGTGTAGCTATAGAAGAAATCCTTGGTGAGATCAACACTAGCCAAAAGTTTCTTGTACCTGTTAATATTTCCTTAAGTTAAATAAATATATACGAGTA[C/T]
CCACAAGTTGAAACTGTAAAGGAGCATAGAAAAGATGAGGAAATGAATGAAAAAAGAAATGTTAGAGAAGGCACAGGAAGAATCACCTTAGCTCATTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 49.30% 0.08% 0.00% NA
All Indica  2759 22.80% 77.10% 0.11% 0.00% NA
All Japonica  1512 98.30% 1.60% 0.07% 0.00% NA
Aus  269 71.40% 28.60% 0.00% 0.00% NA
Indica I  595 43.00% 56.80% 0.17% 0.00% NA
Indica II  465 7.10% 92.70% 0.22% 0.00% NA
Indica III  913 14.00% 85.90% 0.11% 0.00% NA
Indica Intermediate  786 27.00% 73.00% 0.00% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.20% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800452335 G -> A LOC_Os08g01740.1 downstream_gene_variant ; 1946.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800452335 G -> A LOC_Os08g01740.2 downstream_gene_variant ; 1946.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800452335 G -> A LOC_Os08g01750.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800452335 G -> A LOC_Os08g01750.3 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800452335 G -> A LOC_Os08g01750.2 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800452335 NA 7.72E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 NA 3.46E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 NA 5.51E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 NA 8.47E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 6.43E-08 2.35E-19 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 2.00E-08 2.58E-11 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 NA 6.76E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 NA 1.07E-09 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 6.89E-10 NA mr1277_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 5.45E-07 1.07E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 NA 5.52E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 NA 5.36E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 2.23E-09 6.47E-25 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800452335 1.86E-08 5.04E-10 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251