\
| Variant ID: vg0800427985 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 427985 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCCACCATGCGTATATATGTGCATGCATCGCCGGCCGGACTGACTGACAGTAGTAGCAGCTACTACTCCCTCCGTCCCAAAAAAACAAACCCTGGTTTC[T/C]
GTGTCCAACGTACGTCTGTCTTATTTGAAAAAATTATGAAAAAAATTAAAAAGATAAGTCACGCATAAAGTATTAATCATATTTTATCATCTAACAACAA
TTGTTGTTAGATGATAAAATATGATTAATACTTTATGCGTGACTTATCTTTTTAATTTTTTTCATAATTTTTTCAAATAAGACAGACGTACGTTGGACAC[A/G]
GAAACCAGGGTTTGTTTTTTTGGGACGGAGGGAGTAGTAGCTGCTACTACTGTCAGTCAGTCCGGCCGGCGATGCATGCACATATATACGCATGGTGGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.80% | 38.40% | 0.89% | 8.84% | NA |
| All Indica | 2759 | 75.10% | 8.80% | 1.09% | 14.93% | NA |
| All Japonica | 1512 | 1.50% | 98.20% | 0.13% | 0.20% | NA |
| Aus | 269 | 94.10% | 5.20% | 0.37% | 0.37% | NA |
| Indica I | 595 | 63.70% | 9.20% | 2.18% | 24.87% | NA |
| Indica II | 465 | 85.60% | 5.40% | 1.08% | 7.96% | NA |
| Indica III | 913 | 78.00% | 8.30% | 0.77% | 12.92% | NA |
| Indica Intermediate | 786 | 74.30% | 11.20% | 0.64% | 13.87% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 98.00% | 0.40% | 0.60% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 61.50% | 31.20% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 48.90% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800427985 | T -> C | LOC_Os08g01700-LOC_Os08g01710 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800427985 | T -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800427985 | NA | 7.23E-24 | mr1102 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800427985 | NA | 4.72E-12 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800427985 | NA | 4.06E-26 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800427985 | NA | 2.05E-40 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800427985 | NA | 7.72E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800427985 | NA | 7.38E-15 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800427985 | NA | 3.48E-28 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800427985 | NA | 1.35E-13 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800427985 | NA | 9.37E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |