\
| Variant ID: vg0800413021 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 413021 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.03, others allele: 0.00, population size: 195. )
CTATATTTAGAAGTCACCATTTATATCCTAGAGTTTTATGGATTCGTTGTGGTTTTGATAAAAACGGAAAGAAAAGATCGAGTGAATAAGAGCACTCAAC[C/A]
AATTTTAGGAGATTGAGAAAGATTGGATCGTATTTGATGGGGAGTATTGGTTCTGGCATCATACTACACGGTACTGTCTTCGAGGTTGAAGACGGCAGTC
GACTGCCGTCTTCAACCTCGAAGACAGTACCGTGTAGTATGATGCCAGAACCAATACTCCCCATCAAATACGATCCAATCTTTCTCAATCTCCTAAAATT[G/T]
GTTGAGTGCTCTTATTCACTCGATCTTTTCTTTCCGTTTTTATCAAAACCACAACGAATCCATAAAACTCTAGGATATAAATGGTGACTTCTAAATATAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 45.00% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 34.70% | 65.00% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 86.80% | 13.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 92.20% | 7.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 54.80% | 45.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 12.90% | 86.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 31.00% | 68.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 36.60% | 62.50% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 70.60% | 29.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 85.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 40.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800413021 | C -> A | LOC_Os08g01690-LOC_Os08g01700 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800413021 | NA | 3.32E-06 | mr1279 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800413021 | 2.25E-13 | 2.60E-30 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800413021 | 9.57E-11 | 4.95E-14 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800413021 | NA | 1.81E-11 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800413021 | 6.99E-11 | NA | mr1277_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800413021 | 1.43E-08 | 2.82E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800413021 | NA | 9.26E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800413021 | 2.17E-18 | 1.50E-37 | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800413021 | 5.56E-14 | 6.79E-18 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800413021 | NA | 3.59E-11 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800413021 | NA | 6.19E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |