\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800332417:

Variant ID: vg0800332417 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 332417
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATAAAGGAGCCAAGCCAAGTTTTCTTCACAAGACTGCTCACCGTCTCAACACACTGAGGGCAACCAAATCCAAGAGATTAAGGCTCGAGTATTGGAG[G/C]
CGAATAAACGGCGCATAAGGTACATGCCGACAATTGTGTCCCTACTTCTGTTGTTCCCATTGATCCTCGACTGTCCGCACTCTACACGGAGACATCCAGC

Reverse complement sequence

GCTGGATGTCTCCGTGTAGAGTGCGGACAGTCGAGGATCAATGGGAACAACAGAAGTAGGGACACAATTGTCGGCATGTACCTTATGCGCCGTTTATTCG[C/G]
CTCCAATACTCGAGCCTTAATCTCTTGGATTTGGTTGCCCTCAGTGTGTTGAGACGGTGAGCAGTCTTGTGAAGAAAACTTGGCTTGGCTCCTTTATGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 2.50% 0.63% 22.13% NA
All Indica  2759 73.10% 1.60% 0.29% 25.05% NA
All Japonica  1512 87.80% 0.30% 0.07% 11.90% NA
Aus  269 14.90% 23.00% 5.95% 56.13% NA
Indica I  595 90.10% 0.80% 0.00% 9.08% NA
Indica II  465 30.50% 2.80% 0.43% 66.24% NA
Indica III  913 90.90% 0.50% 0.00% 8.54% NA
Indica Intermediate  786 64.60% 2.70% 0.76% 31.93% NA
Temperate Japonica  767 97.50% 0.10% 0.00% 2.35% NA
Tropical Japonica  504 71.80% 0.60% 0.00% 27.58% NA
Japonica Intermediate  241 90.00% 0.00% 0.41% 9.54% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 63.30% 5.60% 4.44% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800332417 G -> C LOC_Os08g01550.1 downstream_gene_variant ; 2400.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800332417 G -> C LOC_Os08g01560.1 downstream_gene_variant ; 41.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800332417 G -> C LOC_Os08g01570.1 downstream_gene_variant ; 2825.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800332417 G -> C LOC_Os08g01560-LOC_Os08g01570 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800332417 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800332417 NA 2.66E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 1.08E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 1.20E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 1.99E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 3.27E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 7.89E-11 mr1248 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 9.48E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 1.33E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 1.85E-11 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 3.97E-15 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 7.74E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 6.83E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 6.08E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 2.53E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 2.08E-13 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 6.13E-14 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 3.75E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 6.76E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 1.96E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 9.16E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 8.16E-15 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417 NA 1.30E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251