Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800332417:

Variant ID: vg0800332417 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 332417
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

ATCATAAAGGAGCCAAGCCAAGTTTTCTTCACAAGACTGCTCACCGTCTCAACACACTGAGGGCAACCAAATCCAAGAGATTAAGGCTCGAGTATTGGAG[G/C]
CGAATAAACGGCGCATAAGGTACATGCCGACAATTGTGTCCCTACTTCTGTTGTTCCCATTGATCCTCGACTGTCCGCACTCTACACGGAGACATCCAGC

Reverse complement sequence

GCTGGATGTCTCCGTGTAGAGTGCGGACAGTCGAGGATCAATGGGAACAACAGAAGTAGGGACACAATTGTCGGCATGTACCTTATGCGCCGTTTATTCG[C/G]
CTCCAATACTCGAGCCTTAATCTCTTGGATTTGGTTGCCCTCAGTGTGTTGAGACGGTGAGCAGTCTTGTGAAGAAAACTTGGCTTGGCTCCTTTATGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	2.50%	0.63%	22.13%	NA
All Indica	2759	73.10%	1.60%	0.29%	25.05%	NA
All Japonica	1512	87.80%	0.30%	0.07%	11.90%	NA
Aus	269	14.90%	23.00%	5.95%	56.13%	NA
Indica I	595	90.10%	0.80%	0.00%	9.08%	NA
Indica II	465	30.50%	2.80%	0.43%	66.24%	NA
Indica III	913	90.90%	0.50%	0.00%	8.54%	NA
Indica Intermediate	786	64.60%	2.70%	0.76%	31.93%	NA
Temperate Japonica	767	97.50%	0.10%	0.00%	2.35%	NA
Tropical Japonica	504	71.80%	0.60%	0.00%	27.58%	NA
Japonica Intermediate	241	90.00%	0.00%	0.41%	9.54%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	63.30%	5.60%	4.44%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800332417	G -> C	LOC_Os08g01550.1	downstream_gene_variant ; 2400.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800332417	G -> C	LOC_Os08g01560.1	downstream_gene_variant ; 41.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800332417	G -> C	LOC_Os08g01570.1	downstream_gene_variant ; 2825.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800332417	G -> C	LOC_Os08g01560-LOC_Os08g01570	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800332417	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800332417	NA	2.66E-09	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	1.08E-10	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	1.20E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	1.99E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	3.27E-11	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	7.89E-11	mr1248	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	9.48E-12	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	1.33E-12	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	1.85E-11	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	3.97E-15	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	7.74E-06	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	6.83E-08	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	6.08E-10	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	2.53E-13	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	2.08E-13	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	6.13E-14	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	3.75E-14	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	6.76E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	1.96E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	9.16E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	8.16E-15	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800332417	NA	1.30E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251