\
| Variant ID: vg0800293632 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 293632 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 204. )
CGAAGTTTATACCTGGGCATATCCTTCGACCAGTCCTGAATGGCAAGAAATTGAAATTATTTCCATTGTAGTCAGCCATTGTGTTGCTAAGGAACCTCTC[T/C]
GGCATGAACTCCTCGGCATTTTCCCAATAGCTAGGGTCCCTGGCAATAGCCCATGCATTGACGATGACACGAGTGCCTGAGGGTATAGTATAGCCCTCGA
TCGAGGGCTATACTATACCCTCAGGCACTCGTGTCATCGTCAATGCATGGGCTATTGCCAGGGACCCTAGCTATTGGGAAAATGCCGAGGAGTTCATGCC[A/G]
GAGAGGTTCCTTAGCAACACAATGGCTGACTACAATGGAAATAATTTCAATTTCTTGCCATTCAGGACTGGTCGAAGGATATGCCCAGGTATAAACTTCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.20% | 40.30% | 0.19% | 0.28% | NA |
| All Indica | 2759 | 38.40% | 60.80% | 0.33% | 0.43% | NA |
| All Japonica | 1512 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.90% | 62.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 31.80% | 67.60% | 0.34% | 0.34% | NA |
| Indica II | 465 | 14.80% | 84.10% | 0.43% | 0.65% | NA |
| Indica III | 913 | 58.80% | 40.50% | 0.33% | 0.33% | NA |
| Indica Intermediate | 786 | 33.70% | 65.50% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800293632 | T -> C | LOC_Os08g01470.1 | synonymous_variant ; p.Pro256Pro; LOW | synonymous_codon | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800293632 | T -> DEL | LOC_Os08g01470.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800293632 | NA | 2.97E-06 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800293632 | 7.24E-07 | NA | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800293632 | 2.06E-08 | 1.45E-11 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800293632 | 1.02E-11 | NA | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800293632 | 4.76E-14 | 1.08E-17 | mr1746 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800293632 | NA | 4.86E-12 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800293632 | 6.58E-08 | NA | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800293632 | 8.17E-09 | 4.97E-11 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800293632 | 1.54E-07 | 3.61E-09 | mr1403_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800293632 | 8.05E-15 | NA | mr1746_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800293632 | 3.49E-16 | 1.13E-21 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |