\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800292156:

Variant ID: vg0800292156 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 292156
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.02, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GACTCAGCAGTCACGTAGGATAAAACCGGGATCAAAACCGTCGAGGGACCTATTGTGACTAGTTTTGCATAATTAAGGGACCCCGCATATCTGGTTTTGT[G/T]
GTTGGAGGACGATTTTGTATCCCGATGAAAAGTTGAGGGACCTTTGGTGTACTTTTTCCATTTGATAATCGCGGAATATGGGCAGGAATTTAATTAGGTC

Reverse complement sequence

GACCTAATTAAATTCCTGCCCATATTCCGCGATTATCAAATGGAAAAAGTACACCAAAGGTCCCTCAACTTTTCATCGGGATACAAAATCGTCCTCCAAC[C/A]
ACAAAACCAGATATGCGGGGTCCCTTAATTATGCAAAACTAGTCACAATAGGTCCCTCGACGGTTTTGATCCCGGTTTTATCCTACGTGACTGCTGAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.70% 0.04% 0.00% NA
All Indica  2759 58.00% 41.90% 0.07% 0.00% NA
All Japonica  1512 88.30% 11.70% 0.00% 0.00% NA
Aus  269 27.10% 72.90% 0.00% 0.00% NA
Indica I  595 68.10% 31.90% 0.00% 0.00% NA
Indica II  465 82.40% 17.60% 0.00% 0.00% NA
Indica III  913 37.80% 62.10% 0.11% 0.00% NA
Indica Intermediate  786 59.40% 40.50% 0.13% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 71.80% 28.20% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800292156 G -> T LOC_Os08g01450.1 upstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800292156 G -> T LOC_Os08g01460.1 downstream_gene_variant ; 83.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800292156 G -> T LOC_Os08g01470.1 downstream_gene_variant ; 1221.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800292156 G -> T LOC_Os08g01480.1 downstream_gene_variant ; 4752.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800292156 G -> T LOC_Os08g01460-LOC_Os08g01470 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800292156 NA 4.27E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 3.25E-08 1.03E-16 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 6.25E-10 7.55E-14 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 3.72E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 1.51E-10 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 3.30E-11 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 8.44E-19 1.76E-27 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 1.24E-15 6.25E-18 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 8.02E-10 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 3.00E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 1.03E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 9.83E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 1.29E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 4.17E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 7.05E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 3.54E-10 5.57E-23 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 1.91E-10 1.22E-13 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 1.46E-08 NA mr1298_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 2.44E-06 1.23E-06 mr1298_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 2.82E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 3.84E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 4.44E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 3.19E-08 NA mr1731_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 4.22E-06 1.39E-06 mr1731_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 9.18E-16 1.89E-29 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 5.15E-11 2.53E-18 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800292156 NA 4.90E-14 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251