Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800287831:

Variant ID: vg0800287831 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 287831
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.06, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

GTACGCCACGTAGACCAAAACCACCGTGGATTGGGTCGAGGGGGGGTAATTCGTCCGGTTTGTATAGTTAGGGGTGAAGAATGTTCGGTTTTGTGGTTCA[G/T]
GTGGTAATTCGGACGACCGCGATAGTTCGGGGAGATAATTCGTACTTTTTCCTTATTTTTATAAGCGATAAAAAAAATCCTACCTCTATAAAAATGCAGC

Reverse complement sequence

GCTGCATTTTTATAGAGGTAGGATTTTTTTTATCGCTTATAAAAATAAGGAAAAAGTACGAATTATCTCCCCGAACTATCGCGGTCGTCCGAATTACCAC[C/A]
TGAACCACAAAACCGAACATTCTTCACCCCTAACTATACAAACCGGACGAATTACCCCCCCTCGACCCAATCCACGGTGGTTTTGGTCTACGTGGCGTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.00%	42.70%	0.08%	2.26%	NA
All Indica	2759	39.90%	58.60%	0.14%	1.38%	NA
All Japonica	1512	87.40%	12.60%	0.00%	0.00%	NA
Aus	269	40.10%	34.60%	0.00%	25.28%	NA
Indica I	595	58.20%	41.80%	0.00%	0.00%	NA
Indica II	465	21.70%	76.10%	0.00%	2.15%	NA
Indica III	913	37.60%	61.90%	0.11%	0.44%	NA
Indica Intermediate	786	39.60%	57.00%	0.38%	3.05%	NA
Temperate Japonica	767	97.40%	2.60%	0.00%	0.00%	NA
Tropical Japonica	504	71.60%	28.40%	0.00%	0.00%	NA
Japonica Intermediate	241	88.80%	11.20%	0.00%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	57.80%	41.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800287831	G -> T	LOC_Os08g01460.1	upstream_gene_variant ; 3464.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800287831	G -> T	LOC_Os08g01440.1	downstream_gene_variant ; 3719.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800287831	G -> T	LOC_Os08g01450.1	downstream_gene_variant ; 947.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800287831	G -> T	LOC_Os08g01440-LOC_Os08g01450	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800287831	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800287831	1.26E-08	1.45E-13	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	1.97E-09	1.57E-08	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	7.09E-06	NA	mr1731	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	7.31E-25	1.43E-50	mr1746	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	2.23E-21	3.96E-28	mr1746	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	NA	7.16E-12	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	NA	3.47E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	NA	9.48E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	2.02E-10	NA	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	1.63E-10	1.33E-07	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	9.94E-07	NA	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	NA	4.27E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	NA	1.52E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	NA	1.37E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	5.68E-06	NA	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	4.30E-30	4.43E-64	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	1.21E-28	6.14E-39	mr1746_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800287831	NA	7.43E-10	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251