| Variant ID: vg0800207863 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 207863 |
| Reference Allele: T | Alternative Allele: C,TC |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.37, others allele: 0.00, population size: 145. )
GCATGCAGAAAACAACATAGGCAGTGCCATAAAAGTTGTATGGGACAAACTCTCATTTGCTTCCTAAATTTTTTTGCTTTGACCCAATTTTGTTTTTTTT[T/C,TC]
CGCCATCTCTCATCTCTAATATCCCCTTTTCTTATGCTCCTTCCATCCCAAAATATATATACAACTTCTAGAGTTCAAATTTTGTCCCAAATAAAACAAC
GTTGTTTTATTTGGGACAAAATTTGAACTCTAGAAGTTGTATATATATTTTGGGATGGAAGGAGCATAAGAAAAGGGGATATTAGAGATGAGAGATGGCG[A/G,GA]
AAAAAAAACAAAATTGGGTCAAAGCAAAAAAATTTAGGAAGCAAATGAGAGTTTGTCCCATACAACTTTTATGGCACTGCCTATGTTGTTTTCTGCATGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 9.00% | 19.38% | 35.29% | TC: 3.62% |
| All Indica | 2759 | 9.60% | 6.60% | 32.00% | 51.76% | TC: 0.04% |
| All Japonica | 1512 | 80.20% | 7.20% | 0.86% | 0.79% | TC: 10.91% |
| Aus | 269 | 5.20% | 45.70% | 2.97% | 46.10% | NA |
| Indica I | 595 | 7.70% | 10.40% | 37.14% | 44.71% | NA |
| Indica II | 465 | 12.90% | 0.90% | 35.48% | 50.75% | NA |
| Indica III | 913 | 7.80% | 5.50% | 25.52% | 61.12% | TC: 0.11% |
| Indica Intermediate | 786 | 11.10% | 8.50% | 33.59% | 46.82% | NA |
| Temperate Japonica | 767 | 84.70% | 12.60% | 0.78% | 0.52% | TC: 1.30% |
| Tropical Japonica | 504 | 70.00% | 1.80% | 0.79% | 0.99% | TC: 26.39% |
| Japonica Intermediate | 241 | 87.10% | 1.20% | 1.24% | 1.24% | TC: 9.13% |
| VI/Aromatic | 96 | 19.80% | 2.10% | 1.04% | 77.08% | NA |
| Intermediate | 90 | 40.00% | 8.90% | 12.22% | 33.33% | TC: 5.56% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800207863 | T -> C | LOC_Os08g01320.1 | upstream_gene_variant ; 4019.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800207863 | T -> C | LOC_Os08g01320.2 | upstream_gene_variant ; 4021.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800207863 | T -> C | LOC_Os08g01330.1 | downstream_gene_variant ; 2550.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800207863 | T -> C | LOC_Os08g01320-LOC_Os08g01330 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800207863 | T -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800207863 | T -> TC | LOC_Os08g01320.1 | upstream_gene_variant ; 4020.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800207863 | T -> TC | LOC_Os08g01320.2 | upstream_gene_variant ; 4022.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800207863 | T -> TC | LOC_Os08g01330.1 | downstream_gene_variant ; 2549.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800207863 | T -> TC | LOC_Os08g01320-LOC_Os08g01330 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800207863 | NA | 3.45E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | 4.18E-06 | 4.65E-08 | mr1252_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 1.61E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 7.36E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 2.81E-06 | mr1318_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 7.97E-06 | mr1381_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 1.53E-09 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 1.63E-06 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 1.91E-07 | mr1638_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 7.52E-10 | mr1702_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 4.53E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 2.09E-07 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 2.21E-08 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 7.98E-06 | mr1813_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800207863 | NA | 2.82E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |