\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800207863:

Variant ID: vg0800207863 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 207863
Reference Allele: TAlternative Allele: C,TC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.37, others allele: 0.00, population size: 145. )

Flanking Sequence (100 bp) in Reference Genome:


GCATGCAGAAAACAACATAGGCAGTGCCATAAAAGTTGTATGGGACAAACTCTCATTTGCTTCCTAAATTTTTTTGCTTTGACCCAATTTTGTTTTTTTT[T/C,TC]
CGCCATCTCTCATCTCTAATATCCCCTTTTCTTATGCTCCTTCCATCCCAAAATATATATACAACTTCTAGAGTTCAAATTTTGTCCCAAATAAAACAAC

Reverse complement sequence

GTTGTTTTATTTGGGACAAAATTTGAACTCTAGAAGTTGTATATATATTTTGGGATGGAAGGAGCATAAGAAAAGGGGATATTAGAGATGAGAGATGGCG[A/G,GA]
AAAAAAAACAAAATTGGGTCAAAGCAAAAAAATTTAGGAAGCAAATGAGAGTTTGTCCCATACAACTTTTATGGCACTGCCTATGTTGTTTTCTGCATGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.70% 9.00% 19.38% 35.29% TC: 3.62%
All Indica  2759 9.60% 6.60% 32.00% 51.76% TC: 0.04%
All Japonica  1512 80.20% 7.20% 0.86% 0.79% TC: 10.91%
Aus  269 5.20% 45.70% 2.97% 46.10% NA
Indica I  595 7.70% 10.40% 37.14% 44.71% NA
Indica II  465 12.90% 0.90% 35.48% 50.75% NA
Indica III  913 7.80% 5.50% 25.52% 61.12% TC: 0.11%
Indica Intermediate  786 11.10% 8.50% 33.59% 46.82% NA
Temperate Japonica  767 84.70% 12.60% 0.78% 0.52% TC: 1.30%
Tropical Japonica  504 70.00% 1.80% 0.79% 0.99% TC: 26.39%
Japonica Intermediate  241 87.10% 1.20% 1.24% 1.24% TC: 9.13%
VI/Aromatic  96 19.80% 2.10% 1.04% 77.08% NA
Intermediate  90 40.00% 8.90% 12.22% 33.33% TC: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800207863 T -> C LOC_Os08g01320.1 upstream_gene_variant ; 4019.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800207863 T -> C LOC_Os08g01320.2 upstream_gene_variant ; 4021.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800207863 T -> C LOC_Os08g01330.1 downstream_gene_variant ; 2550.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800207863 T -> C LOC_Os08g01320-LOC_Os08g01330 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800207863 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800207863 T -> TC LOC_Os08g01320.1 upstream_gene_variant ; 4020.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800207863 T -> TC LOC_Os08g01320.2 upstream_gene_variant ; 4022.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800207863 T -> TC LOC_Os08g01330.1 downstream_gene_variant ; 2549.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800207863 T -> TC LOC_Os08g01320-LOC_Os08g01330 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800207863 NA 3.45E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 4.18E-06 4.65E-08 mr1252_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 1.61E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 7.36E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 2.81E-06 mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 7.97E-06 mr1381_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 1.53E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 1.63E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 1.91E-07 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 7.52E-10 mr1702_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 4.53E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 2.09E-07 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 2.21E-08 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 7.98E-06 mr1813_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800207863 NA 2.82E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251