\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729559113:

Variant ID: vg0729559113 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29559113
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTTATAAGCCAACTATAATCTTATGTGGAAGAGAAAGATAAAGAAAAAAATGAGTGTTAGCTCTCATACAAAAGCTAACTATACATATACTCCAAGAT[T/C]
GATAATCTTTTTTGAAGAAGAGATAGATCTGCCACTACAAATCTTTCCCTGCCATGTTTTGGTATCTCCTCGAAATATATTTATAGTTAGCTTATAGTCT

Reverse complement sequence

AGACTATAAGCTAACTATAAATATATTTCGAGGAGATACCAAAACATGGCAGGGAAAGATTTGTAGTGGCAGATCTATCTCTTCTTCAAAAAAGATTATC[A/G]
ATCTTGGAGTATATGTATAGTTAGCTTTTGTATGAGAGCTAACACTCATTTTTTTCTTTATCTTTCTCTTCCACATAAGATTATAGTTGGCTTATAACCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 28.70% 0.02% 0.00% NA
All Indica  2759 98.40% 1.60% 0.04% 0.00% NA
All Japonica  1512 18.00% 82.00% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 3.20% 0.00% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 36.10% 63.90% 0.00% 0.00% NA
Japonica Intermediate  241 34.40% 65.60% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729559113 T -> C LOC_Os07g49350.1 upstream_gene_variant ; 1074.0bp to feature; MODIFIER silent_mutation Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg0729559113 T -> C LOC_Os07g49340.1 downstream_gene_variant ; 3471.0bp to feature; MODIFIER silent_mutation Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg0729559113 T -> C LOC_Os07g49360.1 downstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N
vg0729559113 T -> C LOC_Os07g49350-LOC_Os07g49360 intergenic_region ; MODIFIER silent_mutation Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729559113 NA 6.70E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729559113 NA 1.35E-33 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729559113 NA 5.66E-33 mr1638 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729559113 NA 2.13E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729559113 NA 2.92E-24 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729559113 NA 7.44E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251