Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0729559113:

Variant ID: vg0729559113 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29559113
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTTATAAGCCAACTATAATCTTATGTGGAAGAGAAAGATAAAGAAAAAAATGAGTGTTAGCTCTCATACAAAAGCTAACTATACATATACTCCAAGAT[T/C]
GATAATCTTTTTTGAAGAAGAGATAGATCTGCCACTACAAATCTTTCCCTGCCATGTTTTGGTATCTCCTCGAAATATATTTATAGTTAGCTTATAGTCT

Reverse complement sequence

AGACTATAAGCTAACTATAAATATATTTCGAGGAGATACCAAAACATGGCAGGGAAAGATTTGTAGTGGCAGATCTATCTCTTCTTCAAAAAAGATTATC[A/G]
ATCTTGGAGTATATGTATAGTTAGCTTTTGTATGAGAGCTAACACTCATTTTTTTCTTTATCTTTCTCTTCCACATAAGATTATAGTTGGCTTATAACCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.30%	28.70%	0.02%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.04%	0.00%	NA
All Japonica	1512	18.00%	82.00%	0.00%	0.00%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	98.30%	1.50%	0.17%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.80%	3.20%	0.00%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	36.10%	63.90%	0.00%	0.00%	NA
Japonica Intermediate	241	34.40%	65.60%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729559113	T -> C	LOC_Os07g49350.1	upstream_gene_variant ; 1074.0bp to feature; MODIFIER	silent_mutation	Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8	N	N	N	N
vg0729559113	T -> C	LOC_Os07g49340.1	downstream_gene_variant ; 3471.0bp to feature; MODIFIER	silent_mutation	Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8	N	N	N	N
vg0729559113	T -> C	LOC_Os07g49360.1	downstream_gene_variant ; 2067.0bp to feature; MODIFIER	silent_mutation	Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8	N	N	N	N
vg0729559113	T -> C	LOC_Os07g49350-LOC_Os07g49360	intergenic_region ; MODIFIER	silent_mutation	Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729559113	NA	6.70E-06	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729559113	NA	1.35E-33	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729559113	NA	5.66E-33	mr1638	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729559113	NA	2.13E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729559113	NA	2.92E-24	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729559113	NA	7.44E-06	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251