\
| Variant ID: vg0729559113 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29559113 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 232. )
GGGTTATAAGCCAACTATAATCTTATGTGGAAGAGAAAGATAAAGAAAAAAATGAGTGTTAGCTCTCATACAAAAGCTAACTATACATATACTCCAAGAT[T/C]
GATAATCTTTTTTGAAGAAGAGATAGATCTGCCACTACAAATCTTTCCCTGCCATGTTTTGGTATCTCCTCGAAATATATTTATAGTTAGCTTATAGTCT
AGACTATAAGCTAACTATAAATATATTTCGAGGAGATACCAAAACATGGCAGGGAAAGATTTGTAGTGGCAGATCTATCTCTTCTTCAAAAAAGATTATC[A/G]
ATCTTGGAGTATATGTATAGTTAGCTTTTGTATGAGAGCTAACACTCATTTTTTTCTTTATCTTTCTCTTCCACATAAGATTATAGTTGGCTTATAACCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.30% | 28.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 18.00% | 82.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 36.10% | 63.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729559113 | T -> C | LOC_Os07g49350.1 | upstream_gene_variant ; 1074.0bp to feature; MODIFIER | silent_mutation | Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8 | N | N | N | N |
| vg0729559113 | T -> C | LOC_Os07g49340.1 | downstream_gene_variant ; 3471.0bp to feature; MODIFIER | silent_mutation | Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8 | N | N | N | N |
| vg0729559113 | T -> C | LOC_Os07g49360.1 | downstream_gene_variant ; 2067.0bp to feature; MODIFIER | silent_mutation | Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8 | N | N | N | N |
| vg0729559113 | T -> C | LOC_Os07g49350-LOC_Os07g49360 | intergenic_region ; MODIFIER | silent_mutation | Average:48.097; most accessible tissue: Zhenshan97 young leaf, score: 60.8 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729559113 | NA | 6.70E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729559113 | NA | 1.35E-33 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729559113 | NA | 5.66E-33 | mr1638 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729559113 | NA | 2.13E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729559113 | NA | 2.92E-24 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729559113 | NA | 7.44E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |