\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729476993:

Variant ID: vg0729476993 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29476993
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAATATAGGCAAAGAAAAACAGATCAAAAATCAAACATCAGCATGTTTTGTCATCTATACAAATTGGTTGAGTCCACAAAAGTATCCTGGAAAAAAAA[T/A]
AGCTATTGCTTATAACAGCAAGTTCGAAGTGAAAATACCAGTTTATATACACATATAAGCAATACCTATATGCATATATAAGCAATATACCAGTTTGGCG

Reverse complement sequence

CGCCAAACTGGTATATTGCTTATATATGCATATAGGTATTGCTTATATGTGTATATAAACTGGTATTTTCACTTCGAACTTGCTGTTATAAGCAATAGCT[A/T]
TTTTTTTTCCAGGATACTTTTGTGGACTCAACCAATTTGTATAGATGACAAAACATGCTGATGTTTGATTTTTGATCTGTTTTTCTTTGCCTATATTTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 6.50% 0.02% 0.00% NA
All Indica  2759 97.60% 2.40% 0.00% 0.00% NA
All Japonica  1512 95.30% 4.70% 0.00% 0.00% NA
Aus  269 68.80% 30.90% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 95.10% 4.90% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 86.90% 13.10% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729476993 T -> A LOC_Os07g49230.1 upstream_gene_variant ; 1768.0bp to feature; MODIFIER silent_mutation Average:40.546; most accessible tissue: Callus, score: 87.467 N N N N
vg0729476993 T -> A LOC_Os07g49230.2 upstream_gene_variant ; 1765.0bp to feature; MODIFIER silent_mutation Average:40.546; most accessible tissue: Callus, score: 87.467 N N N N
vg0729476993 T -> A LOC_Os07g49230.3 upstream_gene_variant ; 1778.0bp to feature; MODIFIER silent_mutation Average:40.546; most accessible tissue: Callus, score: 87.467 N N N N
vg0729476993 T -> A LOC_Os07g49210.1 downstream_gene_variant ; 1494.0bp to feature; MODIFIER silent_mutation Average:40.546; most accessible tissue: Callus, score: 87.467 N N N N
vg0729476993 T -> A LOC_Os07g49220.1 intron_variant ; MODIFIER silent_mutation Average:40.546; most accessible tissue: Callus, score: 87.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729476993 NA 7.48E-07 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993 NA 4.11E-06 mr1133 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993 NA 1.11E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993 NA 5.06E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993 NA 6.89E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993 NA 2.48E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993 NA 7.86E-33 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993 NA 1.81E-10 mr1696 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251