Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0729243816:

Variant ID: vg0729243816 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29243816
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ATCAAGATCCAGATAATTCTATCTCGGCTTTCGTTATTACGTGTTTTTCAAACTGATAAATATATGGTTGGTTTGGTTTGTGACCTAAATAGGCCTTACC[A/C]
AATTTTGTTGGTGTCAAATTTTAGCAAGTTTTGGCATGACTAATTTTGGTAAGGCAAAGTTGTGTTTGGATTGAAGCCAAAATAGTCTAAGTTCACTATT

Reverse complement sequence

AATAGTGAACTTAGACTATTTTGGCTTCAATCCAAACACAACTTTGCCTTACCAAAATTAGTCATGCCAAAACTTGCTAAAATTTGACACCAACAAAATT[T/G]
GGTAAGGCCTATTTAGGTCACAAACCAAACCAACCATATATTTATCAGTTTGAAAAACACGTAATAACGAAAGCCGAGATAGAATTATCTGGATCTTGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	8.00%	0.02%	0.00%	NA
All Indica	2759	97.20%	2.80%	0.04%	0.00%	NA
All Japonica	1512	81.00%	19.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	94.20%	5.80%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	93.90%	6.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	45.40%	54.60%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729243816	A -> C	LOC_Os07g48870.1	downstream_gene_variant ; 188.0bp to feature; MODIFIER	silent_mutation	Average:60.098; most accessible tissue: Callus, score: 92.043	N	N	N	N
vg0729243816	A -> C	LOC_Os07g48880.1	downstream_gene_variant ; 3568.0bp to feature; MODIFIER	silent_mutation	Average:60.098; most accessible tissue: Callus, score: 92.043	N	N	N	N
vg0729243816	A -> C	LOC_Os07g48880.3	downstream_gene_variant ; 3568.0bp to feature; MODIFIER	silent_mutation	Average:60.098; most accessible tissue: Callus, score: 92.043	N	N	N	N
vg0729243816	A -> C	LOC_Os07g48880.4	downstream_gene_variant ; 3568.0bp to feature; MODIFIER	silent_mutation	Average:60.098; most accessible tissue: Callus, score: 92.043	N	N	N	N
vg0729243816	A -> C	LOC_Os07g48880.2	downstream_gene_variant ; 4651.0bp to feature; MODIFIER	silent_mutation	Average:60.098; most accessible tissue: Callus, score: 92.043	N	N	N	N
vg0729243816	A -> C	LOC_Os07g48870-LOC_Os07g48880	intergenic_region ; MODIFIER	silent_mutation	Average:60.098; most accessible tissue: Callus, score: 92.043	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729243816	NA	2.06E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	2.65E-07	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	4.08E-06	mr1837	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	4.76E-06	NA	mr1304_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	1.71E-09	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	6.51E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	2.15E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	1.07E-08	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	2.31E-06	mr1567_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	4.75E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	3.44E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	1.28E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	8.52E-06	2.39E-06	mr1849_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	2.76E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816	NA	8.89E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251