\
| Variant ID: vg0729243816 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 29243816 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 227. )
ATCAAGATCCAGATAATTCTATCTCGGCTTTCGTTATTACGTGTTTTTCAAACTGATAAATATATGGTTGGTTTGGTTTGTGACCTAAATAGGCCTTACC[A/C]
AATTTTGTTGGTGTCAAATTTTAGCAAGTTTTGGCATGACTAATTTTGGTAAGGCAAAGTTGTGTTTGGATTGAAGCCAAAATAGTCTAAGTTCACTATT
AATAGTGAACTTAGACTATTTTGGCTTCAATCCAAACACAACTTTGCCTTACCAAAATTAGTCATGCCAAAACTTGCTAAAATTTGACACCAACAAAATT[T/G]
GGTAAGGCCTATTTAGGTCACAAACCAAACCAACCATATATTTATCAGTTTGAAAAACACGTAATAACGAAAGCCGAGATAGAATTATCTGGATCTTGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 8.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.90% | 6.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 45.40% | 54.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0729243816 | A -> C | LOC_Os07g48870.1 | downstream_gene_variant ; 188.0bp to feature; MODIFIER | silent_mutation | Average:60.098; most accessible tissue: Callus, score: 92.043 | N | N | N | N |
| vg0729243816 | A -> C | LOC_Os07g48880.1 | downstream_gene_variant ; 3568.0bp to feature; MODIFIER | silent_mutation | Average:60.098; most accessible tissue: Callus, score: 92.043 | N | N | N | N |
| vg0729243816 | A -> C | LOC_Os07g48880.3 | downstream_gene_variant ; 3568.0bp to feature; MODIFIER | silent_mutation | Average:60.098; most accessible tissue: Callus, score: 92.043 | N | N | N | N |
| vg0729243816 | A -> C | LOC_Os07g48880.4 | downstream_gene_variant ; 3568.0bp to feature; MODIFIER | silent_mutation | Average:60.098; most accessible tissue: Callus, score: 92.043 | N | N | N | N |
| vg0729243816 | A -> C | LOC_Os07g48880.2 | downstream_gene_variant ; 4651.0bp to feature; MODIFIER | silent_mutation | Average:60.098; most accessible tissue: Callus, score: 92.043 | N | N | N | N |
| vg0729243816 | A -> C | LOC_Os07g48870-LOC_Os07g48880 | intergenic_region ; MODIFIER | silent_mutation | Average:60.098; most accessible tissue: Callus, score: 92.043 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0729243816 | NA | 2.06E-06 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 2.65E-07 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 4.08E-06 | mr1837 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | 4.76E-06 | NA | mr1304_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 1.71E-09 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 6.51E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 2.15E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 1.07E-08 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 2.31E-06 | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 4.75E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 3.44E-07 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 1.28E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | 8.52E-06 | 2.39E-06 | mr1849_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 2.76E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0729243816 | NA | 8.89E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |