\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729243816:

Variant ID: vg0729243816 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29243816
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAAGATCCAGATAATTCTATCTCGGCTTTCGTTATTACGTGTTTTTCAAACTGATAAATATATGGTTGGTTTGGTTTGTGACCTAAATAGGCCTTACC[A/C]
AATTTTGTTGGTGTCAAATTTTAGCAAGTTTTGGCATGACTAATTTTGGTAAGGCAAAGTTGTGTTTGGATTGAAGCCAAAATAGTCTAAGTTCACTATT

Reverse complement sequence

AATAGTGAACTTAGACTATTTTGGCTTCAATCCAAACACAACTTTGCCTTACCAAAATTAGTCATGCCAAAACTTGCTAAAATTTGACACCAACAAAATT[T/G]
GGTAAGGCCTATTTAGGTCACAAACCAAACCAACCATATATTTATCAGTTTGAAAAACACGTAATAACGAAAGCCGAGATAGAATTATCTGGATCTTGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 8.00% 0.02% 0.00% NA
All Indica  2759 97.20% 2.80% 0.04% 0.00% NA
All Japonica  1512 81.00% 19.00% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.20% 5.80% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 93.90% 6.00% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 45.40% 54.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729243816 A -> C LOC_Os07g48870.1 downstream_gene_variant ; 188.0bp to feature; MODIFIER silent_mutation Average:60.098; most accessible tissue: Callus, score: 92.043 N N N N
vg0729243816 A -> C LOC_Os07g48880.1 downstream_gene_variant ; 3568.0bp to feature; MODIFIER silent_mutation Average:60.098; most accessible tissue: Callus, score: 92.043 N N N N
vg0729243816 A -> C LOC_Os07g48880.3 downstream_gene_variant ; 3568.0bp to feature; MODIFIER silent_mutation Average:60.098; most accessible tissue: Callus, score: 92.043 N N N N
vg0729243816 A -> C LOC_Os07g48880.4 downstream_gene_variant ; 3568.0bp to feature; MODIFIER silent_mutation Average:60.098; most accessible tissue: Callus, score: 92.043 N N N N
vg0729243816 A -> C LOC_Os07g48880.2 downstream_gene_variant ; 4651.0bp to feature; MODIFIER silent_mutation Average:60.098; most accessible tissue: Callus, score: 92.043 N N N N
vg0729243816 A -> C LOC_Os07g48870-LOC_Os07g48880 intergenic_region ; MODIFIER silent_mutation Average:60.098; most accessible tissue: Callus, score: 92.043 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729243816 NA 2.06E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 2.65E-07 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 4.08E-06 mr1837 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 4.76E-06 NA mr1304_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 1.71E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 6.51E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 2.15E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 1.07E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 2.31E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 4.75E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 3.44E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 1.28E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 8.52E-06 2.39E-06 mr1849_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 2.76E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729243816 NA 8.89E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251