Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728915189:

Variant ID: vg0728915189 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28915189
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAGAATCCATCACCGTGTCAAGCTCCAAAACCTTGCATTCCATTTTTTTTCTGGAGAAGGGTATTTTTTACCCGGCCTCTATATCCAACCGGATATAT[A/G]
CAGCTTTTTTTTAATAGGAACTTAGCCTAGGAACTTAGCCTATCGAACAGGGAACTAGCCCTCAAATAACCCAATCTGAAATTCGCTCCTATGAAGATTT

Reverse complement sequence

AAATCTTCATAGGAGCGAATTTCAGATTGGGTTATTTGAGGGCTAGTTCCCTGTTCGATAGGCTAAGTTCCTAGGCTAAGTTCCTATTAAAAAAAAGCTG[T/C]
ATATATCCGGTTGGATATAGAGGCCGGGTAAAAAATACCCTTCTCCAGAAAAAAAATGGAATGCAAGGTTTTGGAGCTTGACACGGTGATGGATTCTAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	33.20%	1.06%	0.91%	NA
All Indica	2759	96.40%	3.30%	0.25%	0.04%	NA
All Japonica	1512	7.30%	87.40%	2.51%	2.78%	NA
Aus	269	84.40%	15.20%	0.37%	0.00%	NA
Indica I	595	99.50%	0.20%	0.17%	0.17%	NA
Indica II	465	93.10%	6.00%	0.86%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	93.00%	6.70%	0.25%	0.00%	NA
Temperate Japonica	767	1.60%	93.10%	3.26%	2.09%	NA
Tropical Japonica	504	9.10%	88.90%	0.79%	1.19%	NA
Japonica Intermediate	241	22.00%	66.00%	3.73%	8.30%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	42.20%	53.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728915189	A -> DEL	N	N	silent_mutation	Average:78.715; most accessible tissue: Callus, score: 88.984	N	N	N	N
vg0728915189	A -> G	LOC_Os07g48380.1	upstream_gene_variant ; 2454.0bp to feature; MODIFIER	silent_mutation	Average:78.715; most accessible tissue: Callus, score: 88.984	N	N	N	N
vg0728915189	A -> G	LOC_Os07g48390.1	upstream_gene_variant ; 4388.0bp to feature; MODIFIER	silent_mutation	Average:78.715; most accessible tissue: Callus, score: 88.984	N	N	N	N
vg0728915189	A -> G	LOC_Os07g48370.1	downstream_gene_variant ; 1092.0bp to feature; MODIFIER	silent_mutation	Average:78.715; most accessible tissue: Callus, score: 88.984	N	N	N	N
vg0728915189	A -> G	LOC_Os07g48370-LOC_Os07g48380	intergenic_region ; MODIFIER	silent_mutation	Average:78.715; most accessible tissue: Callus, score: 88.984	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728915189	NA	7.84E-23	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	6.61E-22	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	2.78E-15	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	3.79E-17	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.28E-16	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.47E-15	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	3.37E-13	mr1325	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	5.26E-14	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.52E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.51E-23	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	2.61E-15	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	7.79E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	7.77E-12	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	4.80E-06	mr1695	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.52E-14	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	6.05E-06	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	5.16E-11	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.56E-22	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	4.97E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.66E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.73E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.80E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	4.20E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.91E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.05E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	4.00E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	3.65E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	4.83E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189	NA	1.09E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251