\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728915189:

Variant ID: vg0728915189 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28915189
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, A: 0.43, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAGAATCCATCACCGTGTCAAGCTCCAAAACCTTGCATTCCATTTTTTTTCTGGAGAAGGGTATTTTTTACCCGGCCTCTATATCCAACCGGATATAT[A/G]
CAGCTTTTTTTTAATAGGAACTTAGCCTAGGAACTTAGCCTATCGAACAGGGAACTAGCCCTCAAATAACCCAATCTGAAATTCGCTCCTATGAAGATTT

Reverse complement sequence

AAATCTTCATAGGAGCGAATTTCAGATTGGGTTATTTGAGGGCTAGTTCCCTGTTCGATAGGCTAAGTTCCTAGGCTAAGTTCCTATTAAAAAAAAGCTG[T/C]
ATATATCCGGTTGGATATAGAGGCCGGGTAAAAAATACCCTTCTCCAGAAAAAAAATGGAATGCAAGGTTTTGGAGCTTGACACGGTGATGGATTCTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 33.20% 1.06% 0.91% NA
All Indica  2759 96.40% 3.30% 0.25% 0.04% NA
All Japonica  1512 7.30% 87.40% 2.51% 2.78% NA
Aus  269 84.40% 15.20% 0.37% 0.00% NA
Indica I  595 99.50% 0.20% 0.17% 0.17% NA
Indica II  465 93.10% 6.00% 0.86% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 93.00% 6.70% 0.25% 0.00% NA
Temperate Japonica  767 1.60% 93.10% 3.26% 2.09% NA
Tropical Japonica  504 9.10% 88.90% 0.79% 1.19% NA
Japonica Intermediate  241 22.00% 66.00% 3.73% 8.30% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 42.20% 53.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728915189 A -> DEL N N silent_mutation Average:78.715; most accessible tissue: Callus, score: 88.984 N N N N
vg0728915189 A -> G LOC_Os07g48380.1 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:78.715; most accessible tissue: Callus, score: 88.984 N N N N
vg0728915189 A -> G LOC_Os07g48390.1 upstream_gene_variant ; 4388.0bp to feature; MODIFIER silent_mutation Average:78.715; most accessible tissue: Callus, score: 88.984 N N N N
vg0728915189 A -> G LOC_Os07g48370.1 downstream_gene_variant ; 1092.0bp to feature; MODIFIER silent_mutation Average:78.715; most accessible tissue: Callus, score: 88.984 N N N N
vg0728915189 A -> G LOC_Os07g48370-LOC_Os07g48380 intergenic_region ; MODIFIER silent_mutation Average:78.715; most accessible tissue: Callus, score: 88.984 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728915189 NA 7.84E-23 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 6.61E-22 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 2.78E-15 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 3.79E-17 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.28E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.47E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 3.37E-13 mr1325 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 5.26E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.52E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.51E-23 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 2.61E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 7.79E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 7.77E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 4.80E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.52E-14 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 6.05E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 5.16E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.56E-22 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 4.97E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.66E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.73E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.80E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 4.20E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.91E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.05E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 4.00E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 3.65E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 4.83E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728915189 NA 1.09E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251