Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728914146:

Variant ID: vg0728914146 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28914146
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CCGTCCGTCCTAAAATATAAGAGATTTTAGATGGATGAGACATATCTTAATACTACGAATATGAATAGATTTTGTCCAGATTTTTAGTATTAGGATATTT[T/C]
ACATATATTTAAAATCTCTTATATTTTGGGACAGTGAGAGTATTATCATGGGGGAGAAATGCAGCTACAATCATTGAACTTAAGCTTGAGATTGATTTTC

Reverse complement sequence

GAAAATCAATCTCAAGCTTAAGTTCAATGATTGTAGCTGCATTTCTCCCCCATGATAATACTCTCACTGTCCCAAAATATAAGAGATTTTAAATATATGT[A/G]
AAATATCCTAATACTAAAAATCTGGACAAAATCTATTCATATTCGTAGTATTAAGATATGTCTCATCCATCTAAAATCTCTTATATTTTAGGACGGACGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.90%	34.80%	0.04%	0.28%	NA
All Indica	2759	96.40%	3.20%	0.04%	0.33%	NA
All Japonica	1512	7.30%	92.60%	0.00%	0.13%	NA
Aus	269	85.50%	14.50%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	93.10%	5.80%	0.22%	0.86%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	93.00%	6.40%	0.00%	0.64%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	8.90%	90.90%	0.00%	0.20%	NA
Japonica Intermediate	241	22.00%	77.60%	0.00%	0.41%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	42.20%	54.40%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728914146	T -> DEL	N	N	silent_mutation	Average:72.587; most accessible tissue: Minghui63 flower, score: 84.277	N	N	N	N
vg0728914146	T -> C	LOC_Os07g48380.1	upstream_gene_variant ; 3497.0bp to feature; MODIFIER	silent_mutation	Average:72.587; most accessible tissue: Minghui63 flower, score: 84.277	N	N	N	N
vg0728914146	T -> C	LOC_Os07g48370.1	downstream_gene_variant ; 49.0bp to feature; MODIFIER	silent_mutation	Average:72.587; most accessible tissue: Minghui63 flower, score: 84.277	N	N	N	N
vg0728914146	T -> C	LOC_Os07g48370-LOC_Os07g48380	intergenic_region ; MODIFIER	silent_mutation	Average:72.587; most accessible tissue: Minghui63 flower, score: 84.277	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728914146	NA	6.24E-22	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	2.54E-15	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.80E-16	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.36E-15	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.90E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	5.94E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	4.77E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	2.06E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	4.50E-06	8.48E-07	mr1336	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.41E-23	mr1477	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.12E-13	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	9.89E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.33E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.54E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	6.40E-11	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	4.81E-22	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	4.18E-06	NA	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	3.80E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.66E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.94E-12	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.12E-06	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	1.28E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	5.04E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	8.93E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728914146	NA	2.75E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251