Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0728887297:

Variant ID: vg0728887297 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28887297
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAAAGTAATGCGGTGTCAAAAAAGGAAACAAGGTGGAGAGGTGGAGGGAGGGAAGGGAGGGGGCGCAAAACTGATCTCCCTAGGCGATCGCTCGCCCA[G/A]
TAGCATTCCTGATGAAAATAGACGTATGAGATTTATCCACATCACAATTAGTAAAATATTCATTCCTAAAATTAACTATTATGATGTAGTAGAACAGAAG

Reverse complement sequence

CTTCTGTTCTACTACATCATAATAGTTAATTTTAGGAATGAATATTTTACTAATTGTGATGTGGATAAATCTCATACGTCTATTTTCATCAGGAATGCTA[C/T]
TGGGCGAGCGATCGCCTAGGGAGATCAGTTTTGCGCCCCCTCCCTTCCCTCCCTCCACCTCTCCACCTTGTTTCCTTTTTTGACACCGCATTACTTTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.70%	14.70%	0.68%	0.00%	NA
All Indica	2759	97.30%	2.50%	0.18%	0.00%	NA
All Japonica	1512	63.50%	35.10%	1.39%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	95.90%	3.90%	0.22%	0.00%	NA
Indica III	913	98.50%	1.30%	0.22%	0.00%	NA
Indica Intermediate	786	94.80%	5.00%	0.25%	0.00%	NA
Temperate Japonica	767	95.00%	3.70%	1.30%	0.00%	NA
Tropical Japonica	504	19.40%	79.20%	1.39%	0.00%	NA
Japonica Intermediate	241	55.20%	43.20%	1.66%	0.00%	NA
VI/Aromatic	96	28.10%	67.70%	4.17%	0.00%	NA
Intermediate	90	70.00%	27.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728887297	G -> A	LOC_Os07g48340.1	upstream_gene_variant ; 1943.0bp to feature; MODIFIER	silent_mutation	Average:73.374; most accessible tissue: Minghui63 flower, score: 84.9	N	N	N	N
vg0728887297	G -> A	LOC_Os07g48340.2	upstream_gene_variant ; 1813.0bp to feature; MODIFIER	silent_mutation	Average:73.374; most accessible tissue: Minghui63 flower, score: 84.9	N	N	N	N
vg0728887297	G -> A	LOC_Os07g48330.1	downstream_gene_variant ; 845.0bp to feature; MODIFIER	silent_mutation	Average:73.374; most accessible tissue: Minghui63 flower, score: 84.9	N	N	N	N
vg0728887297	G -> A	LOC_Os07g48330-LOC_Os07g48340	intergenic_region ; MODIFIER	silent_mutation	Average:73.374; most accessible tissue: Minghui63 flower, score: 84.9	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0728887297	G	A	-0.03	-0.01	-0.01	-0.01	-0.02	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728887297	NA	7.80E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	1.95E-13	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	3.37E-08	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	9.56E-06	mr1837	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	2.91E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	3.26E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	7.17E-10	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	7.76E-12	mr1554_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	2.48E-06	mr1562_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	7.32E-06	mr1735_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	9.09E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	2.03E-12	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297	NA	7.98E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251