\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728887297:

Variant ID: vg0728887297 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28887297
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAAAGTAATGCGGTGTCAAAAAAGGAAACAAGGTGGAGAGGTGGAGGGAGGGAAGGGAGGGGGCGCAAAACTGATCTCCCTAGGCGATCGCTCGCCCA[G/A]
TAGCATTCCTGATGAAAATAGACGTATGAGATTTATCCACATCACAATTAGTAAAATATTCATTCCTAAAATTAACTATTATGATGTAGTAGAACAGAAG

Reverse complement sequence

CTTCTGTTCTACTACATCATAATAGTTAATTTTAGGAATGAATATTTTACTAATTGTGATGTGGATAAATCTCATACGTCTATTTTCATCAGGAATGCTA[C/T]
TGGGCGAGCGATCGCCTAGGGAGATCAGTTTTGCGCCCCCTCCCTTCCCTCCCTCCACCTCTCCACCTTGTTTCCTTTTTTGACACCGCATTACTTTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 14.70% 0.68% 0.00% NA
All Indica  2759 97.30% 2.50% 0.18% 0.00% NA
All Japonica  1512 63.50% 35.10% 1.39% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 98.50% 1.30% 0.22% 0.00% NA
Indica Intermediate  786 94.80% 5.00% 0.25% 0.00% NA
Temperate Japonica  767 95.00% 3.70% 1.30% 0.00% NA
Tropical Japonica  504 19.40% 79.20% 1.39% 0.00% NA
Japonica Intermediate  241 55.20% 43.20% 1.66% 0.00% NA
VI/Aromatic  96 28.10% 67.70% 4.17% 0.00% NA
Intermediate  90 70.00% 27.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728887297 G -> A LOC_Os07g48340.1 upstream_gene_variant ; 1943.0bp to feature; MODIFIER silent_mutation Average:73.374; most accessible tissue: Minghui63 flower, score: 84.9 N N N N
vg0728887297 G -> A LOC_Os07g48340.2 upstream_gene_variant ; 1813.0bp to feature; MODIFIER silent_mutation Average:73.374; most accessible tissue: Minghui63 flower, score: 84.9 N N N N
vg0728887297 G -> A LOC_Os07g48330.1 downstream_gene_variant ; 845.0bp to feature; MODIFIER silent_mutation Average:73.374; most accessible tissue: Minghui63 flower, score: 84.9 N N N N
vg0728887297 G -> A LOC_Os07g48330-LOC_Os07g48340 intergenic_region ; MODIFIER silent_mutation Average:73.374; most accessible tissue: Minghui63 flower, score: 84.9 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0728887297 G A -0.03 -0.01 -0.01 -0.01 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728887297 NA 7.80E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 1.95E-13 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 3.37E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 9.56E-06 mr1837 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 2.91E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 3.26E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 7.17E-10 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 7.76E-12 mr1554_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 2.48E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 7.32E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 9.09E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 2.03E-12 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728887297 NA 7.98E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251