| Variant ID: vg0728820356 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 28820356 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGGGCGCCTTTATGCTAGAAAATTGACGCGCCTTATGGCGCGATAAGCATCTAACCCGTATACATTTTATAGAACACATGTAAAAAAATATATAAAAAAA[T/A]
TAAAAATATATTTTTACAACATATATATTTGTATTGCTAAGATGGCTCGAAAAAGGTTATCATTTTCGCTCTAGATGGTAGAAATTTCCACATTAGTCAC
GTGACTAATGTGGAAATTTCTACCATCTAGAGCGAAAATGATAACCTTTTTCGAGCCATCTTAGCAATACAAATATATATGTTGTAAAAATATATTTTTA[A/T]
TTTTTTTATATATTTTTTTACATGTGTTCTATAAAATGTATACGGGTTAGATGCTTATCGCGCCATAAGGCGCGTCAATTTTCTAGCATAAAGGCGCCCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 6.10% | 0.91% | 0.11% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 79.10% | 18.20% | 2.38% | 0.33% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.60% | 0.70% | 2.09% | 0.65% | NA |
| Tropical Japonica | 504 | 48.80% | 49.00% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 9.50% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0728820356 | T -> DEL | N | N | silent_mutation | Average:71.439; most accessible tissue: Callus, score: 80.059 | N | N | N | N |
| vg0728820356 | T -> A | LOC_Os07g48229.1 | upstream_gene_variant ; 570.0bp to feature; MODIFIER | silent_mutation | Average:71.439; most accessible tissue: Callus, score: 80.059 | N | N | N | N |
| vg0728820356 | T -> A | LOC_Os07g48244.1 | downstream_gene_variant ; 1469.0bp to feature; MODIFIER | silent_mutation | Average:71.439; most accessible tissue: Callus, score: 80.059 | N | N | N | N |
| vg0728820356 | T -> A | LOC_Os07g48229-LOC_Os07g48244 | intergenic_region ; MODIFIER | silent_mutation | Average:71.439; most accessible tissue: Callus, score: 80.059 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0728820356 | NA | 2.54E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728820356 | 8.05E-07 | 1.24E-18 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728820356 | 5.55E-10 | 1.09E-18 | mr1410 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728820356 | NA | 3.22E-08 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728820356 | 8.06E-06 | 9.96E-15 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728820356 | NA | 7.16E-07 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728820356 | 9.20E-08 | 4.70E-17 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728820356 | NA | 8.55E-10 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728820356 | NA | 1.07E-09 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |