\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728820356:

Variant ID: vg0728820356 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28820356
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGGCGCCTTTATGCTAGAAAATTGACGCGCCTTATGGCGCGATAAGCATCTAACCCGTATACATTTTATAGAACACATGTAAAAAAATATATAAAAAAA[T/A]
TAAAAATATATTTTTACAACATATATATTTGTATTGCTAAGATGGCTCGAAAAAGGTTATCATTTTCGCTCTAGATGGTAGAAATTTCCACATTAGTCAC

Reverse complement sequence

GTGACTAATGTGGAAATTTCTACCATCTAGAGCGAAAATGATAACCTTTTTCGAGCCATCTTAGCAATACAAATATATATGTTGTAAAAATATATTTTTA[A/T]
TTTTTTTATATATTTTTTTACATGTGTTCTATAAAATGTATACGGGTTAGATGCTTATCGCGCCATAAGGCGCGTCAATTTTCTAGCATAAAGGCGCCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 6.10% 0.91% 0.11% NA
All Indica  2759 99.60% 0.30% 0.11% 0.00% NA
All Japonica  1512 79.10% 18.20% 2.38% 0.33% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.10% 0.80% 0.13% 0.00% NA
Temperate Japonica  767 96.60% 0.70% 2.09% 0.65% NA
Tropical Japonica  504 48.80% 49.00% 2.18% 0.00% NA
Japonica Intermediate  241 86.70% 9.50% 3.73% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 90.00% 7.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728820356 T -> DEL N N silent_mutation Average:71.439; most accessible tissue: Callus, score: 80.059 N N N N
vg0728820356 T -> A LOC_Os07g48229.1 upstream_gene_variant ; 570.0bp to feature; MODIFIER silent_mutation Average:71.439; most accessible tissue: Callus, score: 80.059 N N N N
vg0728820356 T -> A LOC_Os07g48244.1 downstream_gene_variant ; 1469.0bp to feature; MODIFIER silent_mutation Average:71.439; most accessible tissue: Callus, score: 80.059 N N N N
vg0728820356 T -> A LOC_Os07g48229-LOC_Os07g48244 intergenic_region ; MODIFIER silent_mutation Average:71.439; most accessible tissue: Callus, score: 80.059 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728820356 NA 2.54E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728820356 8.05E-07 1.24E-18 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728820356 5.55E-10 1.09E-18 mr1410 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728820356 NA 3.22E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728820356 8.06E-06 9.96E-15 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728820356 NA 7.16E-07 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728820356 9.20E-08 4.70E-17 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728820356 NA 8.55E-10 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728820356 NA 1.07E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251