\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728416802:

Variant ID: vg0728416802 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28416802
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGATTGATTTTGTACTCTGGGGCATTTTAGTCAGTTTAGAATATAAAATGATTTATTTTCTGTTTCGTAAATAAACTTTAACGGTGTAGTGAAAACA[A/G]
GGTCAGACGGCAGTTCCGATTTTAAAAAGCAGAGTTAAATGGGCAAAGTTAAAAAATTAGGGTCAAATTAGTAGTTAGACTTCAGAATAGGGTCAAATGA

Reverse complement sequence

TCATTTGACCCTATTCTGAAGTCTAACTACTAATTTGACCCTAATTTTTTAACTTTGCCCATTTAACTCTGCTTTTTAAAATCGGAACTGCCGTCTGACC[T/C]
TGTTTTCACTACACCGTTAAAGTTTATTTACGAAACAGAAAATAAATCATTTTATATTCTAAACTGACTAAAATGCCCCAGAGTACAAAATCAATCATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.00% 19.40% 27.13% 7.55% NA
All Indica  2759 40.40% 4.50% 42.37% 12.69% NA
All Japonica  1512 49.10% 49.50% 1.26% 0.13% NA
Aus  269 90.00% 1.10% 7.81% 1.12% NA
Indica I  595 46.90% 4.40% 35.29% 13.45% NA
Indica II  465 62.20% 3.00% 26.24% 8.60% NA
Indica III  913 18.50% 5.10% 64.51% 11.83% NA
Indica Intermediate  786 48.20% 4.70% 31.55% 15.52% NA
Temperate Japonica  767 18.10% 81.50% 0.39% 0.00% NA
Tropical Japonica  504 88.70% 8.50% 2.38% 0.40% NA
Japonica Intermediate  241 65.10% 33.20% 1.66% 0.00% NA
VI/Aromatic  96 27.10% 17.70% 55.21% 0.00% NA
Intermediate  90 50.00% 25.60% 22.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728416802 A -> DEL N N silent_mutation Average:96.903; most accessible tissue: Minghui63 flower, score: 99.456 N N N N
vg0728416802 A -> G LOC_Os07g47520.1 upstream_gene_variant ; 939.0bp to feature; MODIFIER silent_mutation Average:96.903; most accessible tissue: Minghui63 flower, score: 99.456 N N N N
vg0728416802 A -> G LOC_Os07g47510.1 downstream_gene_variant ; 3647.0bp to feature; MODIFIER silent_mutation Average:96.903; most accessible tissue: Minghui63 flower, score: 99.456 N N N N
vg0728416802 A -> G LOC_Os07g47510.2 downstream_gene_variant ; 3647.0bp to feature; MODIFIER silent_mutation Average:96.903; most accessible tissue: Minghui63 flower, score: 99.456 N N N N
vg0728416802 A -> G LOC_Os07g47510-LOC_Os07g47520 intergenic_region ; MODIFIER silent_mutation Average:96.903; most accessible tissue: Minghui63 flower, score: 99.456 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0728416802 A G 0.06 0.05 0.05 0.05 0.05 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728416802 NA 2.57E-14 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728416802 NA 4.80E-21 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728416802 NA 1.12E-16 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728416802 NA 7.36E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 9.64E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 6.23E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 8.84E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 6.91E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 7.53E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 3.23E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 3.68E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 7.90E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 1.13E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 7.25E-08 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 1.58E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 9.62E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 7.06E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 3.63E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 9.61E-07 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 1.19E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 5.99E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 5.22E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 2.24E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 6.79E-11 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 2.80E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 3.42E-08 mr1851_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 1.47E-11 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 2.87E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728416802 NA 2.18E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251