\
| Variant ID: vg0728389220 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 28389220 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 350. )
TGCTTTGTTTCATCCACAGTTTATGCATGTAACTGAGGGTCCTTGTGCGTAGGTTTAGAAATGGTGCTAATCATGTTACGGGTGACCAGAGGAGATTCAG[T/C]
TAGATGCCAACAAGATAACGCTGAAACAAAATAGATCGATGATCTAACATGTAGCAAATGGTATTGTGACAAAATAGATGGTCTTTTGGAGCTGAGTGAC
GTCACTCAGCTCCAAAAGACCATCTATTTTGTCACAATACCATTTGCTACATGTTAGATCATCGATCTATTTTGTTTCAGCGTTATCTTGTTGGCATCTA[A/G]
CTGAATCTCCTCTGGTCACCCGTAACATGATTAGCACCATTTCTAAACCTACGCACAAGGACCCTCAGTTACATGCATAAACTGTGGATGAAACAAAGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 2.60% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.30% | 7.30% | 0.33% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.90% | 8.60% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 5.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0728389220 | T -> C | LOC_Os07g47490.1 | downstream_gene_variant ; 2505.0bp to feature; MODIFIER | silent_mutation | Average:58.54; most accessible tissue: Callus, score: 88.056 | N | N | N | N |
| vg0728389220 | T -> C | LOC_Os07g47490.2 | downstream_gene_variant ; 2478.0bp to feature; MODIFIER | silent_mutation | Average:58.54; most accessible tissue: Callus, score: 88.056 | N | N | N | N |
| vg0728389220 | T -> C | LOC_Os07g47490.4 | downstream_gene_variant ; 2478.0bp to feature; MODIFIER | silent_mutation | Average:58.54; most accessible tissue: Callus, score: 88.056 | N | N | N | N |
| vg0728389220 | T -> C | LOC_Os07g47490.3 | downstream_gene_variant ; 2505.0bp to feature; MODIFIER | silent_mutation | Average:58.54; most accessible tissue: Callus, score: 88.056 | N | N | N | N |
| vg0728389220 | T -> C | LOC_Os07g47480-LOC_Os07g47490 | intergenic_region ; MODIFIER | silent_mutation | Average:58.54; most accessible tissue: Callus, score: 88.056 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0728389220 | NA | 4.75E-12 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0728389220 | NA | 2.88E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728389220 | NA | 3.44E-06 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728389220 | NA | 7.18E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728389220 | NA | 9.10E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728389220 | NA | 1.52E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728389220 | 4.44E-06 | 4.44E-06 | mr1464 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728389220 | NA | 2.87E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728389220 | NA | 6.73E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728389220 | NA | 5.10E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |