Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0728389220:

Variant ID: vg0728389220 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28389220
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 350. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTTTGTTTCATCCACAGTTTATGCATGTAACTGAGGGTCCTTGTGCGTAGGTTTAGAAATGGTGCTAATCATGTTACGGGTGACCAGAGGAGATTCAG[T/C]
TAGATGCCAACAAGATAACGCTGAAACAAAATAGATCGATGATCTAACATGTAGCAAATGGTATTGTGACAAAATAGATGGTCTTTTGGAGCTGAGTGAC

Reverse complement sequence

GTCACTCAGCTCCAAAAGACCATCTATTTTGTCACAATACCATTTGCTACATGTTAGATCATCGATCTATTTTGTTTCAGCGTTATCTTGTTGGCATCTA[A/G]
CTGAATCTCCTCTGGTCACCCGTAACATGATTAGCACCATTTCTAAACCTACGCACAAGGACCCTCAGTTACATGCATAAACTGTGGATGAAACAAAGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.30%	2.60%	0.11%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	92.30%	7.30%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	90.90%	8.60%	0.52%	0.00%	NA
Tropical Japonica	504	94.60%	5.20%	0.20%	0.00%	NA
Japonica Intermediate	241	92.10%	7.90%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728389220	T -> C	LOC_Os07g47490.1	downstream_gene_variant ; 2505.0bp to feature; MODIFIER	silent_mutation	Average:58.54; most accessible tissue: Callus, score: 88.056	N	N	N	N
vg0728389220	T -> C	LOC_Os07g47490.2	downstream_gene_variant ; 2478.0bp to feature; MODIFIER	silent_mutation	Average:58.54; most accessible tissue: Callus, score: 88.056	N	N	N	N
vg0728389220	T -> C	LOC_Os07g47490.4	downstream_gene_variant ; 2478.0bp to feature; MODIFIER	silent_mutation	Average:58.54; most accessible tissue: Callus, score: 88.056	N	N	N	N
vg0728389220	T -> C	LOC_Os07g47490.3	downstream_gene_variant ; 2505.0bp to feature; MODIFIER	silent_mutation	Average:58.54; most accessible tissue: Callus, score: 88.056	N	N	N	N
vg0728389220	T -> C	LOC_Os07g47480-LOC_Os07g47490	intergenic_region ; MODIFIER	silent_mutation	Average:58.54; most accessible tissue: Callus, score: 88.056	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728389220	NA	4.75E-12	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728389220	NA	2.88E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728389220	NA	3.44E-06	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728389220	NA	7.18E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728389220	NA	9.10E-06	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728389220	NA	1.52E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728389220	4.44E-06	4.44E-06	mr1464	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728389220	NA	2.87E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728389220	NA	6.73E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728389220	NA	5.10E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251