\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728385374:

Variant ID: vg0728385374 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28385374
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATTAATACGTGATTAAAAATAGATTAATATGGTTTATAAAACAATTTTTTTATATATGTATTTTCAAAAAAAAAGTCTGTTTAATAATTTAAGAAGCG[T/A]
GGACGTAAAAAAAAAGAGAAAGAAGAGACGGCAACATTAACAACCCAACACAGCTGTTGGTCAAAGTTGTGTTGTGACCAAAAGGAGCACAGAGACTGTT

Reverse complement sequence

AACAGTCTCTGTGCTCCTTTTGGTCACAACACAACTTTGACCAACAGCTGTGTTGGGTTGTTAATGTTGCCGTCTCTTCTTTCTCTTTTTTTTTACGTCC[A/T]
CGCTTCTTAAATTATTAAACAGACTTTTTTTTTGAAAATACATATATAAAAAAATTGTTTTATAAACCATATTAATCTATTTTTAATCACGTATTAATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 6.20% 0.25% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 93.60% 6.10% 0.33% 0.00% NA
Aus  269 27.90% 69.90% 2.23% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 81.50% 17.70% 0.79% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728385374 T -> A LOC_Os07g47480.2 downstream_gene_variant ; 1229.0bp to feature; MODIFIER silent_mutation Average:76.658; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0728385374 T -> A LOC_Os07g47480.1 downstream_gene_variant ; 1229.0bp to feature; MODIFIER silent_mutation Average:76.658; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0728385374 T -> A LOC_Os07g47480-LOC_Os07g47490 intergenic_region ; MODIFIER silent_mutation Average:76.658; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728385374 NA 2.12E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 5.99E-08 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 3.38E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 8.16E-07 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 3.58E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 4.16E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 1.35E-07 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 1.26E-40 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 2.86E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 1.29E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 7.14E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 2.11E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 2.23E-08 NA mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 3.41E-08 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 2.81E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374 NA 1.12E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251