\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728000317:

Variant ID: vg0728000317 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28000317
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGATATTAAAGTTTATGGTACCTACAGATGCCAAATATATTTGGATAGTAAAATTGCTCGTTCATACTGGTTTAATGGCCCATCAACTTTGATATTTGC[A/G]
CATGGCCTATTCACATCATCTCGGACAATATCGTTACCAAATGATGGGTGTGGTTATATTTACAACGCCGCATTTTCTATACTCCCTCCGTTTCGAAATG

Reverse complement sequence

CATTTCGAAACGGAGGGAGTATAGAAAATGCGGCGTTGTAAATATAACCACACCCATCATTTGGTAACGATATTGTCCGAGATGATGTGAATAGGCCATG[T/C]
GCAAATATCAAAGTTGATGGGCCATTAAACCAGTATGAACGAGCAATTTTACTATCCAAATATATTTGGCATCTGTAGGTACCATAAACTTTAATATCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 3.40% 1.35% 0.00% NA
All Indica  2759 98.70% 0.00% 1.27% 0.00% NA
All Japonica  1512 87.70% 10.60% 1.65% 0.00% NA
Aus  269 98.10% 0.40% 1.49% 0.00% NA
Indica I  595 96.00% 0.00% 4.03% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 0.00% 1.27% 0.00% NA
Temperate Japonica  767 98.20% 1.20% 0.65% 0.00% NA
Tropical Japonica  504 86.70% 12.30% 0.99% 0.00% NA
Japonica Intermediate  241 56.40% 37.30% 6.22% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728000317 A -> G LOC_Os07g46846.1 upstream_gene_variant ; 2270.0bp to feature; MODIFIER silent_mutation Average:35.878; most accessible tissue: Callus, score: 64.202 N N N N
vg0728000317 A -> G LOC_Os07g46852.1 upstream_gene_variant ; 4549.0bp to feature; MODIFIER silent_mutation Average:35.878; most accessible tissue: Callus, score: 64.202 N N N N
vg0728000317 A -> G LOC_Os07g46852.4 upstream_gene_variant ; 4541.0bp to feature; MODIFIER silent_mutation Average:35.878; most accessible tissue: Callus, score: 64.202 N N N N
vg0728000317 A -> G LOC_Os07g46852.3 upstream_gene_variant ; 4549.0bp to feature; MODIFIER silent_mutation Average:35.878; most accessible tissue: Callus, score: 64.202 N N N N
vg0728000317 A -> G LOC_Os07g46852.2 upstream_gene_variant ; 4554.0bp to feature; MODIFIER silent_mutation Average:35.878; most accessible tissue: Callus, score: 64.202 N N N N
vg0728000317 A -> G LOC_Os07g46840.1 downstream_gene_variant ; 3068.0bp to feature; MODIFIER silent_mutation Average:35.878; most accessible tissue: Callus, score: 64.202 N N N N
vg0728000317 A -> G LOC_Os07g46840-LOC_Os07g46846 intergenic_region ; MODIFIER silent_mutation Average:35.878; most accessible tissue: Callus, score: 64.202 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728000317 2.09E-06 7.67E-08 mr1113 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 2.98E-07 2.37E-10 mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 2.02E-06 5.13E-08 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 1.05E-08 7.04E-13 mr1117 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 NA 3.10E-09 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 5.65E-07 4.77E-09 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 7.18E-08 1.59E-09 mr1120 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 1.91E-06 1.35E-09 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 8.71E-06 4.45E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 6.94E-06 1.20E-09 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 3.67E-08 1.17E-10 mr1247 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 1.29E-07 5.67E-11 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 NA 3.48E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 NA 9.09E-10 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 6.47E-06 6.07E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 NA 8.46E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 8.10E-08 2.17E-11 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 7.03E-09 7.00E-13 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 4.34E-12 1.69E-17 mr1117_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 2.23E-06 4.46E-10 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 2.25E-11 4.25E-16 mr1119_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 3.67E-09 1.09E-12 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 1.03E-07 4.39E-11 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 5.63E-07 4.58E-12 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 3.54E-07 1.46E-11 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 3.47E-09 6.21E-13 mr1247_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 5.32E-10 7.06E-16 mr1496_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 NA 5.03E-09 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 8.73E-06 1.54E-08 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 1.53E-06 6.37E-09 mr1936_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728000317 7.58E-07 2.81E-08 mr1961_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251