\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727914669:

Variant ID: vg0727914669 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27914669
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


CCATAAGGTCCATGGCAAAAACACCACCCATCCATGTTGAGTCTATAACACATATGTCGTCAACATGGTTACATCATGTCTATCTCCGTATTTATAGAGA[T/C]
GACCCAGGTTATAAATCTTGATACTAGCGGTATTCATTTACCACGATTAACTCAAAAGTCATCTTGCAACTTATTCGACACATATTCCAACAATAATCTT

Reverse complement sequence

AAGATTATTGTTGGAATATGTGTCGAATAAGTTGCAAGATGACTTTTGAGTTAATCGTGGTAAATGAATACCGCTAGTATCAAGATTTATAACCTGGGTC[A/G]
TCTCTATAAATACGGAGATAGACATGATGTAACCATGTTGACGACATATGTGTTATAGACTCAACATGGATGGGTGGTGTTTTTGCCATGGACCTTATGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 39.10% 0.17% 0.08% NA
All Indica  2759 67.50% 32.00% 0.29% 0.14% NA
All Japonica  1512 55.30% 44.70% 0.00% 0.00% NA
Aus  269 21.60% 78.40% 0.00% 0.00% NA
Indica I  595 49.60% 49.60% 0.67% 0.17% NA
Indica II  465 73.10% 26.20% 0.43% 0.22% NA
Indica III  913 76.60% 23.30% 0.00% 0.11% NA
Indica Intermediate  786 67.30% 32.30% 0.25% 0.13% NA
Temperate Japonica  767 91.80% 8.20% 0.00% 0.00% NA
Tropical Japonica  504 12.10% 87.90% 0.00% 0.00% NA
Japonica Intermediate  241 29.50% 70.50% 0.00% 0.00% NA
VI/Aromatic  96 59.40% 40.60% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727914669 T -> DEL N N silent_mutation Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0727914669 T -> C LOC_Os07g46690.1 upstream_gene_variant ; 2460.0bp to feature; MODIFIER silent_mutation Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0727914669 T -> C LOC_Os07g46700.1 downstream_gene_variant ; 652.0bp to feature; MODIFIER silent_mutation Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0727914669 T -> C LOC_Os07g46700.2 downstream_gene_variant ; 1068.0bp to feature; MODIFIER silent_mutation Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0727914669 T -> C LOC_Os07g46700.3 downstream_gene_variant ; 1068.0bp to feature; MODIFIER silent_mutation Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0727914669 T -> C LOC_Os07g46700.4 downstream_gene_variant ; 1068.0bp to feature; MODIFIER silent_mutation Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0727914669 T -> C LOC_Os07g46690-LOC_Os07g46700 intergenic_region ; MODIFIER silent_mutation Average:54.223; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727914669 NA 8.72E-08 mr1460 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727914669 NA 1.46E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727914669 5.93E-06 1.86E-07 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727914669 NA 6.31E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251