Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0727868341:

Variant ID: vg0727868341 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 27868341
Reference Allele: T	Alternative Allele: G,TAG
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCGATTGTGATTTTAGATTTTCCATCGTTTCTGCGTTTATGTTCCCACGGGCGTGTCCAGTTTAAGAGTACAAGCGGCCGACCCGAGAATCCACCTATA[T/G,TAG]
GGTGGGTTTGGATAATGGGAAATAAGGGTGGGATTGGAATTAGAAAATAAATGAAGGGTTAGGATTAAATGGAAGAGGGAGAATGAATGGTTAGGATTTA

Reverse complement sequence

TAAATCCTAACCATTCATTCTCCCTCTTCCATTTAATCCTAACCCTTCATTTATTTTCTAATTCCAATCCCACCCTTATTTCCCATTATCCAAACCCACC[A/C,CTA]
TATAGGTGGATTCTCGGGTCGGCCGCTTGTACTCTTAAACTGGACACGCCCGTGGGAACATAAACGCAGAAACGATGGAAAATCTAAAATCACAATCGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	40.10%	0.21%	0.02%	TAG: 0.02%
All Indica	2759	60.00%	39.60%	0.29%	0.04%	TAG: 0.04%
All Japonica	1512	54.60%	45.30%	0.13%	0.00%	NA
Aus	269	78.10%	21.90%	0.00%	0.00%	NA
Indica I	595	49.40%	49.90%	0.50%	0.17%	NA
Indica II	465	71.80%	28.00%	0.22%	0.00%	NA
Indica III	913	64.50%	35.40%	0.11%	0.00%	NA
Indica Intermediate	786	55.90%	43.60%	0.38%	0.00%	TAG: 0.13%
Temperate Japonica	767	22.30%	77.70%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.00%	0.20%	0.00%	NA
Japonica Intermediate	241	73.00%	26.60%	0.41%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	63.30%	36.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727868341	T -> DEL	N	N	silent_mutation	Average:89.116; most accessible tissue: Zhenshan97 root, score: 95.906	N	N	N	N
vg0727868341	T -> TAG	LOC_Os07g46630.1	downstream_gene_variant ; 110.0bp to feature; MODIFIER	silent_mutation	Average:89.116; most accessible tissue: Zhenshan97 root, score: 95.906	N	N	N	N
vg0727868341	T -> TAG	LOC_Os07g46640.1	downstream_gene_variant ; 501.0bp to feature; MODIFIER	silent_mutation	Average:89.116; most accessible tissue: Zhenshan97 root, score: 95.906	N	N	N	N
vg0727868341	T -> TAG	LOC_Os07g46640.2	downstream_gene_variant ; 501.0bp to feature; MODIFIER	silent_mutation	Average:89.116; most accessible tissue: Zhenshan97 root, score: 95.906	N	N	N	N
vg0727868341	T -> TAG	LOC_Os07g46630-LOC_Os07g46640	intergenic_region ; MODIFIER	silent_mutation	Average:89.116; most accessible tissue: Zhenshan97 root, score: 95.906	N	N	N	N
vg0727868341	T -> G	LOC_Os07g46630.1	downstream_gene_variant ; 109.0bp to feature; MODIFIER	silent_mutation	Average:89.116; most accessible tissue: Zhenshan97 root, score: 95.906	N	N	N	N
vg0727868341	T -> G	LOC_Os07g46640.1	downstream_gene_variant ; 502.0bp to feature; MODIFIER	silent_mutation	Average:89.116; most accessible tissue: Zhenshan97 root, score: 95.906	N	N	N	N
vg0727868341	T -> G	LOC_Os07g46640.2	downstream_gene_variant ; 502.0bp to feature; MODIFIER	silent_mutation	Average:89.116; most accessible tissue: Zhenshan97 root, score: 95.906	N	N	N	N
vg0727868341	T -> G	LOC_Os07g46630-LOC_Os07g46640	intergenic_region ; MODIFIER	silent_mutation	Average:89.116; most accessible tissue: Zhenshan97 root, score: 95.906	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0727868341	T	G	0.0	0.01	0.0	0.02	0.0	0.0
vg0727868341	T	TAG	0.08	0.16	0.16	0.13	0.12	0.13

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727868341	3.42E-06	3.30E-08	mr1207	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727868341	NA	2.50E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727868341	9.45E-06	9.45E-06	mr1312_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727868341	NA	4.43E-06	mr1633_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727868341	5.31E-06	5.31E-06	mr1665_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727868341	1.22E-06	1.22E-06	mr1822_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727868341	NA	4.18E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251