\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727614840:

Variant ID: vg0727614840 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27614840
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGCTGAAAAATTGTGTGTATGACAGGTTGATGTGATGGAAAAGGGCTGAAGTTTGGATCCAAACTTTTAATTTAAACACAGCCTAGCTAGCACCGATT[G/A]
GGGTTAGCCTGAAGTACTCACTCCCACCATTTTAAATTACTACTCCCTTCGTACCAAATTATAAGTATTTTTAGAAGAGTGAAGTTAAACTTTTTAAATT

Reverse complement sequence

AATTTAAAAAGTTTAACTTCACTCTTCTAAAAATACTTATAATTTGGTACGAAGGGAGTAGTAATTTAAAATGGTGGGAGTGAGTACTTCAGGCTAACCC[C/T]
AATCGGTGCTAGCTAGGCTGTGTTTAAATTAAAAGTTTGGATCCAAACTTCAGCCCTTTTCCATCACATCAACCTGTCATACACACAATTTTTCAGCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 49.30% 0.34% 0.00% NA
All Indica  2759 29.10% 70.30% 0.54% 0.00% NA
All Japonica  1512 95.20% 4.80% 0.00% 0.00% NA
Aus  269 31.20% 68.80% 0.00% 0.00% NA
Indica I  595 58.30% 41.00% 0.67% 0.00% NA
Indica II  465 10.50% 88.40% 1.08% 0.00% NA
Indica III  913 12.60% 87.30% 0.11% 0.00% NA
Indica Intermediate  786 37.30% 62.10% 0.64% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 88.90% 11.10% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727614840 G -> A LOC_Os07g46270.1 upstream_gene_variant ; 1641.0bp to feature; MODIFIER silent_mutation Average:90.148; most accessible tissue: Zhenshan97 flower, score: 95.472 N N N N
vg0727614840 G -> A LOC_Os07g46280.1 upstream_gene_variant ; 577.0bp to feature; MODIFIER silent_mutation Average:90.148; most accessible tissue: Zhenshan97 flower, score: 95.472 N N N N
vg0727614840 G -> A LOC_Os07g46280.2 upstream_gene_variant ; 557.0bp to feature; MODIFIER silent_mutation Average:90.148; most accessible tissue: Zhenshan97 flower, score: 95.472 N N N N
vg0727614840 G -> A LOC_Os07g46280.3 upstream_gene_variant ; 577.0bp to feature; MODIFIER silent_mutation Average:90.148; most accessible tissue: Zhenshan97 flower, score: 95.472 N N N N
vg0727614840 G -> A LOC_Os07g46270-LOC_Os07g46280 intergenic_region ; MODIFIER silent_mutation Average:90.148; most accessible tissue: Zhenshan97 flower, score: 95.472 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727614840 G A 0.0 0.0 0.01 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727614840 NA 3.26E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 2.21E-06 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 5.99E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 6.31E-07 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 8.90E-10 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 3.42E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 2.02E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 8.39E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 4.30E-06 NA mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 4.43E-06 mr1401 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 2.12E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 4.94E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 4.08E-08 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 7.05E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 1.43E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 1.64E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 6.69E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 2.21E-06 NA mr1734 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 5.87E-07 mr1734 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 4.96E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 4.88E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 3.85E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 7.17E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727614840 NA 1.99E-20 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251