\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727498088:

Variant ID: vg0727498088 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27498088
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


ACACGAACAGCTTCGCCACCGCCGCCGCCGCTCCCCACCGCCGTCGTCCCGACCGTCGCCGCCGCCGCTCGGCATGCTACTCAATTTGTTGCAACCATGC[C/T]
CTTTCGTGTTAAATGTGGTGTTCTTTTCTTCTAAAAAGGAAGATGAAGATTAATTTTTTTACGCAAAACGAGATGGTATTAATGTATGATTGATTAAGTT

Reverse complement sequence

AACTTAATCAATCATACATTAATACCATCTCGTTTTGCGTAAAAAAATTAATCTTCATCTTCCTTTTTAGAAGAAAAGAACACCACATTTAACACGAAAG[G/A]
GCATGGTTGCAACAAATTGAGTAGCATGCCGAGCGGCGGCGGCGACGGTCGGGACGACGGCGGTGGGGAGCGGCGGCGGCGGTGGCGAAGCTGTTCGTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 27.80% 4.27% 0.72% NA
All Indica  2759 52.20% 41.50% 5.69% 0.69% NA
All Japonica  1512 98.20% 0.90% 0.93% 0.00% NA
Aus  269 68.80% 16.70% 8.92% 5.58% NA
Indica I  595 67.10% 29.70% 3.03% 0.17% NA
Indica II  465 23.70% 65.80% 9.25% 1.29% NA
Indica III  913 56.10% 37.80% 5.81% 0.33% NA
Indica Intermediate  786 53.20% 40.20% 5.47% 1.15% NA
Temperate Japonica  767 99.10% 0.80% 0.13% 0.00% NA
Tropical Japonica  504 97.00% 0.40% 2.58% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 87.50% 6.25% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727498088 C -> DEL N N silent_mutation Average:45.871; most accessible tissue: Callus, score: 78.046 N N N N
vg0727498088 C -> T LOC_Os07g46080.1 upstream_gene_variant ; 3749.0bp to feature; MODIFIER silent_mutation Average:45.871; most accessible tissue: Callus, score: 78.046 N N N N
vg0727498088 C -> T LOC_Os07g46070.1 downstream_gene_variant ; 392.0bp to feature; MODIFIER silent_mutation Average:45.871; most accessible tissue: Callus, score: 78.046 N N N N
vg0727498088 C -> T LOC_Os07g46070-LOC_Os07g46080 intergenic_region ; MODIFIER silent_mutation Average:45.871; most accessible tissue: Callus, score: 78.046 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727498088 NA 4.53E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 1.21E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 8.82E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 7.43E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 5.12E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 3.50E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 2.25E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 5.82E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 1.67E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 8.11E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 2.23E-08 mr1875 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 7.69E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 9.19E-06 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 2.46E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 2.01E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088 NA 9.61E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251