Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727498088:

Variant ID: vg0727498088 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27498088
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

ACACGAACAGCTTCGCCACCGCCGCCGCCGCTCCCCACCGCCGTCGTCCCGACCGTCGCCGCCGCCGCTCGGCATGCTACTCAATTTGTTGCAACCATGC[C/T]
CTTTCGTGTTAAATGTGGTGTTCTTTTCTTCTAAAAAGGAAGATGAAGATTAATTTTTTTACGCAAAACGAGATGGTATTAATGTATGATTGATTAAGTT

Reverse complement sequence

AACTTAATCAATCATACATTAATACCATCTCGTTTTGCGTAAAAAAATTAATCTTCATCTTCCTTTTTAGAAGAAAAGAACACCACATTTAACACGAAAG[G/A]
GCATGGTTGCAACAAATTGAGTAGCATGCCGAGCGGCGGCGGCGACGGTCGGGACGACGGCGGTGGGGAGCGGCGGCGGCGGTGGCGAAGCTGTTCGTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	27.80%	4.27%	0.72%	NA
All Indica	2759	52.20%	41.50%	5.69%	0.69%	NA
All Japonica	1512	98.20%	0.90%	0.93%	0.00%	NA
Aus	269	68.80%	16.70%	8.92%	5.58%	NA
Indica I	595	67.10%	29.70%	3.03%	0.17%	NA
Indica II	465	23.70%	65.80%	9.25%	1.29%	NA
Indica III	913	56.10%	37.80%	5.81%	0.33%	NA
Indica Intermediate	786	53.20%	40.20%	5.47%	1.15%	NA
Temperate Japonica	767	99.10%	0.80%	0.13%	0.00%	NA
Tropical Japonica	504	97.00%	0.40%	2.58%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	87.50%	6.25%	0.00%	NA
Intermediate	90	70.00%	28.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727498088	C -> DEL	N	N	silent_mutation	Average:45.871; most accessible tissue: Callus, score: 78.046	N	N	N	N
vg0727498088	C -> T	LOC_Os07g46080.1	upstream_gene_variant ; 3749.0bp to feature; MODIFIER	silent_mutation	Average:45.871; most accessible tissue: Callus, score: 78.046	N	N	N	N
vg0727498088	C -> T	LOC_Os07g46070.1	downstream_gene_variant ; 392.0bp to feature; MODIFIER	silent_mutation	Average:45.871; most accessible tissue: Callus, score: 78.046	N	N	N	N
vg0727498088	C -> T	LOC_Os07g46070-LOC_Os07g46080	intergenic_region ; MODIFIER	silent_mutation	Average:45.871; most accessible tissue: Callus, score: 78.046	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727498088	NA	4.53E-06	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	1.21E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	8.82E-06	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	7.43E-07	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	5.12E-06	mr1543	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	3.50E-10	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	2.25E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	5.82E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	1.67E-11	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	8.11E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	2.23E-08	mr1875	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	7.69E-06	mr1888	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	9.19E-06	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	2.46E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	2.01E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727498088	NA	9.61E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251