Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0727272382:

Variant ID: vg0727272382 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27272382
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.36, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

CATCCTTCTCGTACGTCGGCTTCCTGAGCTGTGGAAACCGACAGACCAATCTTGCTGCGGCACTGCTACAGTGCAGTAGACAACGACCACTTGACATTTG[T/C,A]
GAGCTGTGGATGTGGTTTACCGCGTCCATCTTCTGTTTCCATACACCGATTGATTGTGCTATTCTCAACTGGGCCTACAAACGTCTTCTCTAGGCGTCAT

Reverse complement sequence

ATGACGCCTAGAGAAGACGTTTGTAGGCCCAGTTGAGAATAGCACAATCAATCGGTGTATGGAAACAGAAGATGGACGCGGTAAACCACATCCACAGCTC[A/G,T]
CAAATGTCAAGTGGTCGTTGTCTACTGCACTGTAGCAGTGCCGCAGCAAGATTGGTCTGTCGGTTTCCACAGCTCAGGAAGCCGACGTACGAGAAGGATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.00%	27.20%	1.74%	26.98%	A: 0.02%
All Indica	2759	21.30%	37.80%	2.65%	38.27%	A: 0.04%
All Japonica	1512	92.50%	6.30%	0.20%	0.99%	NA
Aus	269	10.80%	46.50%	0.74%	42.01%	NA
Indica I	595	32.30%	46.90%	1.68%	19.16%	NA
Indica II	465	24.50%	14.80%	4.09%	56.56%	NA
Indica III	913	3.90%	50.40%	2.74%	42.83%	A: 0.11%
Indica Intermediate	786	31.20%	29.80%	2.42%	36.64%	NA
Temperate Japonica	767	96.10%	3.10%	0.00%	0.78%	NA
Tropical Japonica	504	85.70%	12.50%	0.60%	1.19%	NA
Japonica Intermediate	241	95.40%	3.30%	0.00%	1.24%	NA
VI/Aromatic	96	13.50%	7.30%	3.12%	76.04%	NA
Intermediate	90	58.90%	20.00%	1.11%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727272382	T -> DEL	N	N	silent_mutation	Average:11.728; most accessible tissue: Callus, score: 41.458	N	N	N	N
vg0727272382	T -> A	LOC_Os07g45670.1	upstream_gene_variant ; 1957.0bp to feature; MODIFIER	silent_mutation	Average:11.728; most accessible tissue: Callus, score: 41.458	N	N	N	N
vg0727272382	T -> A	LOC_Os07g45680.1	upstream_gene_variant ; 597.0bp to feature; MODIFIER	silent_mutation	Average:11.728; most accessible tissue: Callus, score: 41.458	N	N	N	N
vg0727272382	T -> A	LOC_Os07g45670-LOC_Os07g45680	intergenic_region ; MODIFIER	silent_mutation	Average:11.728; most accessible tissue: Callus, score: 41.458	N	N	N	N
vg0727272382	T -> C	LOC_Os07g45670.1	upstream_gene_variant ; 1957.0bp to feature; MODIFIER	silent_mutation	Average:11.728; most accessible tissue: Callus, score: 41.458	N	N	N	N
vg0727272382	T -> C	LOC_Os07g45680.1	upstream_gene_variant ; 597.0bp to feature; MODIFIER	silent_mutation	Average:11.728; most accessible tissue: Callus, score: 41.458	N	N	N	N
vg0727272382	T -> C	LOC_Os07g45670-LOC_Os07g45680	intergenic_region ; MODIFIER	silent_mutation	Average:11.728; most accessible tissue: Callus, score: 41.458	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727272382	NA	3.42E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727272382	5.22E-07	5.22E-07	mr1412	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251