Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0727091511:

Variant ID: vg0727091511 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27091511
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.10, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGACGCCCGATCAGCTGGCACGCCCTTGGTCAGCGCCTCCTCGATCGGCGCTGCCCCGTCGGTCAGTGCCACCCGAGCCAGCACCGTGTCACCATTCC[A/G]
CCATGTCTACACCCGTCGGCCCACCGTGACGGTCCCGCCATCATCTTCACCCAATGTGGTTGTCACGGCTGCTGCTCCTCAGCCGCATTCCATGGTGACG

Reverse complement sequence

CGTCACCATGGAATGCGGCTGAGGAGCAGCAGCCGTGACAACCACATTGGGTGAAGATGATGGCGGGACCGTCACGGTGGGCCGACGGGTGTAGACATGG[T/C]
GGAATGGTGACACGGTGCTGGCTCGGGTGGCACTGACCGACGGGGCAGCGCCGATCGAGGAGGCGCTGACCAAGGGCGTGCCAGCTGATCGGGCGTCACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 35.70% 0.25% 0.00% NA
All Indica  2759 90.80% 9.20% 0.07% 0.00% NA
All Japonica  1512 8.10% 91.50% 0.33% 0.00% NA
Aus  269 96.30% 1.90% 1.86% 0.00% NA
Indica I  595 91.40% 8.40% 0.17% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 79.40% 20.50% 0.13% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 16.50% 82.50% 0.99% 0.00% NA
Japonica Intermediate  241 12.90% 87.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727091511 A -> G LOC_Os07g45410.1 missense_variant ; p.His1634Arg; MODERATE nonsynonymous_codon ; H1634R Average:59.539; most accessible tissue: Zhenshan97 panicle, score: 79.071 unknown unknown TOLERATED 0.49

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727091511 1.09E-06 8.83E-08 mr1120 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 9.19E-06 7.99E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 5.89E-06 4.13E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 3.14E-06 mr1682 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 2.00E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 2.79E-18 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 3.29E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 8.85E-23 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 6.45E-14 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 6.68E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 2.28E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 1.06E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 1.59E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 1.09E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 7.76E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 5.81E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 8.12E-21 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 2.47E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 4.76E-19 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 2.89E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727091511 NA 2.68E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251