\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726931196:

Variant ID: vg0726931196 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26931196
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.04, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TCATTTTTTTTACCGAACTAATGGTCACTTTACTTTCTACTTATCACTCCGTCCCATAATATAAGGGATTTTAAGTTTTTGCTTGCACTGTTTGACCACT[C/T]
GTTTTATTCAAAAAATTTATACAAATATAAAAAAACGAAAGGTTGTGCTTAAAGTACTTTTGATAATAAAGTAAGTCAAAAAATAAATAATATTTCTAAT

Reverse complement sequence

ATTAGAAATATTATTTATTTTTTGACTTACTTTATTATCAAAAGTACTTTAAGCACAACCTTTCGTTTTTTTATATTTGTATAAATTTTTTGAATAAAAC[G/A]
AGTGGTCAAACAGTGCAAGCAAAAACTTAAAATCCCTTATATTATGGGACGGAGTGATAAGTAGAAAGTAAAGTGACCATTAGTTCGGTAAAAAAAATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 40.20% 0.91% 0.00% NA
All Indica  2759 88.50% 10.40% 1.05% 0.00% NA
All Japonica  1512 2.10% 97.40% 0.53% 0.00% NA
Aus  269 62.80% 36.10% 1.12% 0.00% NA
Indica I  595 89.60% 8.10% 2.35% 0.00% NA
Indica II  465 94.00% 4.90% 1.08% 0.00% NA
Indica III  913 90.70% 8.90% 0.44% 0.00% NA
Indica Intermediate  786 81.90% 17.30% 0.76% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 3.40% 95.00% 1.59% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 50.00% 46.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726931196 C -> T LOC_Os07g45120.1 upstream_gene_variant ; 3115.0bp to feature; MODIFIER silent_mutation Average:59.122; most accessible tissue: Callus, score: 89.502 N N N N
vg0726931196 C -> T LOC_Os07g45110.1 downstream_gene_variant ; 2931.0bp to feature; MODIFIER silent_mutation Average:59.122; most accessible tissue: Callus, score: 89.502 N N N N
vg0726931196 C -> T LOC_Os07g45110-LOC_Os07g45120 intergenic_region ; MODIFIER silent_mutation Average:59.122; most accessible tissue: Callus, score: 89.502 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726931196 NA 7.04E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 1.00E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 1.00E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 2.32E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 4.14E-06 mr1298_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 1.28E-07 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 9.10E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 7.54E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 1.67E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 6.00E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 1.08E-07 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 1.10E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 9.37E-08 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 1.14E-07 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 4.68E-07 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 3.89E-08 mr1729_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 6.53E-06 mr1731_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 2.30E-07 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 4.44E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 8.36E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931196 NA 6.45E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251