Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726783003:

Variant ID: vg0726783003 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26783003
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCACAACTCACAAGGAAAAAGTCTAGGGCCTGTTTTGGGGGAGCTTGTTCCAGCTGCAGTTTTTCCTAAAAACTGATTCTGCTAGAAGTTGCCTCAAACA[G/A]
TCCACAACTTCTGAGAATCTGTAGTTACAAATTCTGAAAAATGAACTAAAAAATCAGAAGCTGGAGAAGCTGGGTTTCAGAGCTTTTCTAGATTATCAAA

Reverse complement sequence

TTTGATAATCTAGAAAAGCTCTGAAACCCAGCTTCTCCAGCTTCTGATTTTTTAGTTCATTTTTCAGAATTTGTAACTACAGATTCTCAGAAGTTGTGGA[C/T]
TGTTTGAGGCAACTTCTAGCAGAATCAGTTTTTAGGAAAAACTGCAGCTGGAACAAGCTCCCCCAAAACAGGCCCTAGACTTTTTCCTTGTGAGTTGTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.20%	10.80%	0.02%	0.00%	NA
All Indica	2759	97.90%	2.10%	0.00%	0.00%	NA
All Japonica	1512	71.20%	28.80%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	93.60%	6.40%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.50%	0.00%	0.00%	NA
Temperate Japonica	767	96.10%	3.90%	0.00%	0.00%	NA
Tropical Japonica	504	22.40%	77.40%	0.20%	0.00%	NA
Japonica Intermediate	241	93.80%	6.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726783003	G -> A	LOC_Os07g44860.1	3_prime_UTR_variant ; 449.0bp to feature; MODIFIER	silent_mutation	Average:79.356; most accessible tissue: Callus, score: 91.501	N	N	N	N
vg0726783003	G -> A	LOC_Os07g44840.1	upstream_gene_variant ; 4324.0bp to feature; MODIFIER	silent_mutation	Average:79.356; most accessible tissue: Callus, score: 91.501	N	N	N	N
vg0726783003	G -> A	LOC_Os07g44850.1	downstream_gene_variant ; 1496.0bp to feature; MODIFIER	silent_mutation	Average:79.356; most accessible tissue: Callus, score: 91.501	N	N	N	N
vg0726783003	G -> A	LOC_Os07g44870.1	downstream_gene_variant ; 1994.0bp to feature; MODIFIER	silent_mutation	Average:79.356; most accessible tissue: Callus, score: 91.501	N	N	N	N
vg0726783003	G -> A	LOC_Os07g44880.1	downstream_gene_variant ; 3857.0bp to feature; MODIFIER	silent_mutation	Average:79.356; most accessible tissue: Callus, score: 91.501	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726783003	NA	1.08E-10	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	8.29E-06	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	3.77E-10	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	1.19E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	5.63E-15	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	9.35E-16	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	1.73E-12	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	9.50E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	4.17E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	2.35E-11	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	3.69E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	2.67E-06	NA	mr1539_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	1.05E-16	mr1539_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	7.51E-18	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	2.50E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	4.14E-17	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	3.60E-13	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003	NA	2.53E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251