\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726783003:

Variant ID: vg0726783003 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26783003
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACAACTCACAAGGAAAAAGTCTAGGGCCTGTTTTGGGGGAGCTTGTTCCAGCTGCAGTTTTTCCTAAAAACTGATTCTGCTAGAAGTTGCCTCAAACA[G/A]
TCCACAACTTCTGAGAATCTGTAGTTACAAATTCTGAAAAATGAACTAAAAAATCAGAAGCTGGAGAAGCTGGGTTTCAGAGCTTTTCTAGATTATCAAA

Reverse complement sequence

TTTGATAATCTAGAAAAGCTCTGAAACCCAGCTTCTCCAGCTTCTGATTTTTTAGTTCATTTTTCAGAATTTGTAACTACAGATTCTCAGAAGTTGTGGA[C/T]
TGTTTGAGGCAACTTCTAGCAGAATCAGTTTTTAGGAAAAACTGCAGCTGGAACAAGCTCCCCCAAAACAGGCCCTAGACTTTTTCCTTGTGAGTTGTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.20% 10.80% 0.02% 0.00% NA
All Indica  2759 97.90% 2.10% 0.00% 0.00% NA
All Japonica  1512 71.20% 28.80% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 93.60% 6.40% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 96.10% 3.90% 0.00% 0.00% NA
Tropical Japonica  504 22.40% 77.40% 0.20% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726783003 G -> A LOC_Os07g44860.1 3_prime_UTR_variant ; 449.0bp to feature; MODIFIER silent_mutation Average:79.356; most accessible tissue: Callus, score: 91.501 N N N N
vg0726783003 G -> A LOC_Os07g44840.1 upstream_gene_variant ; 4324.0bp to feature; MODIFIER silent_mutation Average:79.356; most accessible tissue: Callus, score: 91.501 N N N N
vg0726783003 G -> A LOC_Os07g44850.1 downstream_gene_variant ; 1496.0bp to feature; MODIFIER silent_mutation Average:79.356; most accessible tissue: Callus, score: 91.501 N N N N
vg0726783003 G -> A LOC_Os07g44870.1 downstream_gene_variant ; 1994.0bp to feature; MODIFIER silent_mutation Average:79.356; most accessible tissue: Callus, score: 91.501 N N N N
vg0726783003 G -> A LOC_Os07g44880.1 downstream_gene_variant ; 3857.0bp to feature; MODIFIER silent_mutation Average:79.356; most accessible tissue: Callus, score: 91.501 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726783003 NA 1.08E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 8.29E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 3.77E-10 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 1.19E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 5.63E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 9.35E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 1.73E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 9.50E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 4.17E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 2.35E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 3.69E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 2.67E-06 NA mr1539_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 1.05E-16 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 7.51E-18 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 2.50E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 4.14E-17 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 3.60E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726783003 NA 2.53E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251