Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726547648:

Variant ID: vg0726547648 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26547648
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TCTGGCGTCTTGTCTTGGCGTATGTCAACTTGTATGTTGTGGCTTCTGTTGTTCCATGTATGTTGTGGTGGGTGTCTTCCATGGTGGGTGTGTCCTCTCT[C/T]
CTCTTAGGGGGTCTTGTATTTATACCCATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAAACCAATATGAATACAATCTAAGTAGTCCTTGTCGTTTCC

Reverse complement sequence

GGAAACGACAAGGACTACTTAGATTGTATTCATATTGGTTTCCCTAGTTCTACTTGGACAAGGGGACACCTATGGGTATAAATACAAGACCCCCTAAGAG[G/A]
AGAGAGGACACACCCACCATGGAAGACACCCACCACAACATACATGGAACAACAGAAGCCACAACATACAAGTTGACATACGCCAAGACAAGACGCCAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.90%	17.10%	0.04%	0.00%	NA
All Indica	2759	71.20%	28.70%	0.07%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	32.50%	67.50%	0.00%	0.00%	NA
Indica III	913	71.40%	28.60%	0.00%	0.00%	NA
Indica Intermediate	786	72.30%	27.50%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726547648	C -> T	LOC_Os07g44420.1	upstream_gene_variant ; 19.0bp to feature; MODIFIER	silent_mutation	Average:53.121; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0726547648	C -> T	LOC_Os07g44430.1	upstream_gene_variant ; 1004.0bp to feature; MODIFIER	silent_mutation	Average:53.121; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0726547648	C -> T	LOC_Os07g44440.1	upstream_gene_variant ; 4133.0bp to feature; MODIFIER	silent_mutation	Average:53.121; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0726547648	C -> T	LOC_Os07g44410.1	downstream_gene_variant ; 2465.0bp to feature; MODIFIER	silent_mutation	Average:53.121; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0726547648	C -> T	LOC_Os07g44420-LOC_Os07g44430	intergenic_region ; MODIFIER	silent_mutation	Average:53.121; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726547648	NA	2.23E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	2.25E-08	mr1212	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	9.59E-08	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	2.05E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	6.44E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	3.70E-06	mr1543	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	6.89E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	1.48E-11	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	6.39E-07	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	1.56E-09	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	3.47E-10	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	3.11E-13	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	4.95E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	7.27E-08	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	8.08E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	5.89E-07	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	3.36E-10	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648	NA	1.65E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251