\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726547648:

Variant ID: vg0726547648 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26547648
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGGCGTCTTGTCTTGGCGTATGTCAACTTGTATGTTGTGGCTTCTGTTGTTCCATGTATGTTGTGGTGGGTGTCTTCCATGGTGGGTGTGTCCTCTCT[C/T]
CTCTTAGGGGGTCTTGTATTTATACCCATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAAACCAATATGAATACAATCTAAGTAGTCCTTGTCGTTTCC

Reverse complement sequence

GGAAACGACAAGGACTACTTAGATTGTATTCATATTGGTTTCCCTAGTTCTACTTGGACAAGGGGACACCTATGGGTATAAATACAAGACCCCCTAAGAG[G/A]
AGAGAGGACACACCCACCATGGAAGACACCCACCACAACATACATGGAACAACAGAAGCCACAACATACAAGTTGACATACGCCAAGACAAGACGCCAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 17.10% 0.04% 0.00% NA
All Indica  2759 71.20% 28.70% 0.07% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 32.50% 67.50% 0.00% 0.00% NA
Indica III  913 71.40% 28.60% 0.00% 0.00% NA
Indica Intermediate  786 72.30% 27.50% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726547648 C -> T LOC_Os07g44420.1 upstream_gene_variant ; 19.0bp to feature; MODIFIER silent_mutation Average:53.121; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0726547648 C -> T LOC_Os07g44430.1 upstream_gene_variant ; 1004.0bp to feature; MODIFIER silent_mutation Average:53.121; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0726547648 C -> T LOC_Os07g44440.1 upstream_gene_variant ; 4133.0bp to feature; MODIFIER silent_mutation Average:53.121; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0726547648 C -> T LOC_Os07g44410.1 downstream_gene_variant ; 2465.0bp to feature; MODIFIER silent_mutation Average:53.121; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0726547648 C -> T LOC_Os07g44420-LOC_Os07g44430 intergenic_region ; MODIFIER silent_mutation Average:53.121; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726547648 NA 2.23E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 2.25E-08 mr1212 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 9.59E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 2.05E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 6.44E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 3.70E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 6.89E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 1.48E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 6.39E-07 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 1.56E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 3.47E-10 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 3.11E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 4.95E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 7.27E-08 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 8.08E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 5.89E-07 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 3.36E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726547648 NA 1.65E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251