Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726431700:

Variant ID: vg0726431700 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26431700
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTTTTTTAGCATCATCAGCAATGATCTAAAGGTTTGGTTTGACATTAACAAGTGCCTTCTATGACAGTAAAAGACACTTGGTTTCTTGCCCTGCGTCA[A/G]
TCTGTTGTGCAAATATGTGAATCAAGGACATCAATGTATTAGGAGTTTAGGACACAATTTAATGCTAAGCAGATAGAAAATCTATTATTACCTGTTCACT

Reverse complement sequence

AGTGAACAGGTAATAATAGATTTTCTATCTGCTTAGCATTAAATTGTGTCCTAAACTCCTAATACATTGATGTCCTTGATTCACATATTTGCACAACAGA[T/C]
TGACGCAGGGCAAGAAACCAAGTGTCTTTTACTGTCATAGAAGGCACTTGTTAATGTCAAACCAAACCTTTAGATCATTGCTGATGATGCTAAAAAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.20%	24.30%	0.49%	0.00%	NA
All Indica	2759	98.00%	1.80%	0.14%	0.00%	NA
All Japonica	1512	28.10%	70.80%	1.06%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.60%	4.70%	0.67%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.50%	0.00%	0.00%	NA
Temperate Japonica	767	3.90%	96.00%	0.13%	0.00%	NA
Tropical Japonica	504	67.90%	30.60%	1.59%	0.00%	NA
Japonica Intermediate	241	22.00%	75.10%	2.90%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	68.90%	28.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726431700	A -> G	LOC_Os07g44220.1	upstream_gene_variant ; 422.0bp to feature; MODIFIER	silent_mutation	Average:36.022; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0726431700	A -> G	LOC_Os07g44230.1	upstream_gene_variant ; 1001.0bp to feature; MODIFIER	silent_mutation	Average:36.022; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0726431700	A -> G	LOC_Os07g44230.2	upstream_gene_variant ; 1001.0bp to feature; MODIFIER	silent_mutation	Average:36.022; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0726431700	A -> G	LOC_Os07g44210.1	downstream_gene_variant ; 2365.0bp to feature; MODIFIER	silent_mutation	Average:36.022; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0726431700	A -> G	LOC_Os07g44220-LOC_Os07g44230	intergenic_region ; MODIFIER	silent_mutation	Average:36.022; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726431700	NA	1.11E-55	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0726431700	NA	4.52E-17	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	6.51E-11	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	8.98E-27	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	6.95E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	8.08E-25	mr1805	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	1.74E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	2.69E-15	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	1.26E-14	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	7.11E-15	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	2.14E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	1.37E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	2.89E-25	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	1.64E-22	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	8.22E-06	8.22E-06	mr1325_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	3.43E-21	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	4.33E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	1.18E-07	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	1.43E-16	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	4.46E-41	mr1805_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	2.74E-06	mr1819_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	1.83E-13	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700	NA	4.29E-17	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251