\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726431700:

Variant ID: vg0726431700 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26431700
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTTTTAGCATCATCAGCAATGATCTAAAGGTTTGGTTTGACATTAACAAGTGCCTTCTATGACAGTAAAAGACACTTGGTTTCTTGCCCTGCGTCA[A/G]
TCTGTTGTGCAAATATGTGAATCAAGGACATCAATGTATTAGGAGTTTAGGACACAATTTAATGCTAAGCAGATAGAAAATCTATTATTACCTGTTCACT

Reverse complement sequence

AGTGAACAGGTAATAATAGATTTTCTATCTGCTTAGCATTAAATTGTGTCCTAAACTCCTAATACATTGATGTCCTTGATTCACATATTTGCACAACAGA[T/C]
TGACGCAGGGCAAGAAACCAAGTGTCTTTTACTGTCATAGAAGGCACTTGTTAATGTCAAACCAAACCTTTAGATCATTGCTGATGATGCTAAAAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 24.30% 0.49% 0.00% NA
All Indica  2759 98.00% 1.80% 0.14% 0.00% NA
All Japonica  1512 28.10% 70.80% 1.06% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.60% 4.70% 0.67% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 3.90% 96.00% 0.13% 0.00% NA
Tropical Japonica  504 67.90% 30.60% 1.59% 0.00% NA
Japonica Intermediate  241 22.00% 75.10% 2.90% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 68.90% 28.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726431700 A -> G LOC_Os07g44220.1 upstream_gene_variant ; 422.0bp to feature; MODIFIER silent_mutation Average:36.022; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0726431700 A -> G LOC_Os07g44230.1 upstream_gene_variant ; 1001.0bp to feature; MODIFIER silent_mutation Average:36.022; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0726431700 A -> G LOC_Os07g44230.2 upstream_gene_variant ; 1001.0bp to feature; MODIFIER silent_mutation Average:36.022; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0726431700 A -> G LOC_Os07g44210.1 downstream_gene_variant ; 2365.0bp to feature; MODIFIER silent_mutation Average:36.022; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0726431700 A -> G LOC_Os07g44220-LOC_Os07g44230 intergenic_region ; MODIFIER silent_mutation Average:36.022; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726431700 NA 1.11E-55 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0726431700 NA 4.52E-17 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 6.51E-11 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 8.98E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 6.95E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 8.08E-25 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 1.74E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 2.69E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 1.26E-14 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 7.11E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 2.14E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 1.37E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 2.89E-25 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 1.64E-22 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 8.22E-06 8.22E-06 mr1325_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 3.43E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 4.33E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 1.18E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 1.43E-16 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 4.46E-41 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 2.74E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 1.83E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726431700 NA 4.29E-17 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251