\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726430587:

Variant ID: vg0726430587 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26430587
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.56, C: 0.44, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACAGAGACATATGATAAATAGGTAGGTAAATATATCATCCAAACCGTAGCAATCCAAGAGAT[T/C]
GAATATACTAATGCAGCCTTGAGCGATGCCGACGTAGATGACAAATTCACCAGGGCCCGACGGAACGTAGGACTTACCCCTTCGCCGGAGATCGAACTGA

Reverse complement sequence

TCAGTTCGATCTCCGGCGAAGGGGTAAGTCCTACGTTCCGTCGGGCCCTGGTGAATTTGTCATCTACGTCGGCATCGCTCAAGGCTGCATTAGTATATTC[A/G]
ATCTCTTGGATTGCTACGGTTTGGATGATATATTTACCTACCTATTTATCATATGTCTCTGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.50% 24.00% 17.50% 10.05% NA
All Indica  2759 54.60% 10.00% 19.03% 16.38% NA
All Japonica  1512 34.80% 54.70% 10.32% 0.20% NA
Aus  269 69.90% 0.40% 23.79% 5.95% NA
Indica I  595 60.70% 1.70% 26.72% 10.92% NA
Indica II  465 33.80% 10.30% 19.78% 36.13% NA
Indica III  913 58.50% 17.50% 12.38% 11.61% NA
Indica Intermediate  786 57.90% 7.30% 20.48% 14.38% NA
Temperate Japonica  767 4.30% 91.90% 3.52% 0.26% NA
Tropical Japonica  504 76.60% 4.80% 18.45% 0.20% NA
Japonica Intermediate  241 44.40% 40.70% 14.94% 0.00% NA
VI/Aromatic  96 31.20% 3.10% 64.58% 1.04% NA
Intermediate  90 44.40% 30.00% 22.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726430587 T -> DEL N N silent_mutation Average:23.298; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0726430587 T -> C LOC_Os07g44230.1 upstream_gene_variant ; 2114.0bp to feature; MODIFIER silent_mutation Average:23.298; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0726430587 T -> C LOC_Os07g44230.2 upstream_gene_variant ; 2114.0bp to feature; MODIFIER silent_mutation Average:23.298; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0726430587 T -> C LOC_Os07g44210.1 downstream_gene_variant ; 1252.0bp to feature; MODIFIER silent_mutation Average:23.298; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0726430587 T -> C LOC_Os07g44220.1 downstream_gene_variant ; 374.0bp to feature; MODIFIER silent_mutation Average:23.298; most accessible tissue: Minghui63 root, score: 43.505 N N N N
vg0726430587 T -> C LOC_Os07g44210-LOC_Os07g44220 intergenic_region ; MODIFIER silent_mutation Average:23.298; most accessible tissue: Minghui63 root, score: 43.505 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726430587 NA 5.36E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 1.51E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 5.73E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 1.31E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 3.14E-11 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 5.39E-17 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 1.96E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 8.95E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 5.86E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 1.89E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 2.21E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 1.89E-08 4.99E-19 mr1853 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 3.32E-06 3.32E-06 mr1853 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 7.08E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 5.23E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 1.30E-07 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 7.40E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 2.54E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 5.82E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 1.39E-18 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 1.85E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 5.60E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 4.02E-07 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 3.75E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 4.40E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 6.57E-07 2.92E-10 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 2.31E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 7.19E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 7.42E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 1.66E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726430587 NA 1.16E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251