\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726399988:

Variant ID: vg0726399988 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 26399988
Reference Allele: AAlternative Allele: T,AT
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, AT: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTGAGATATTACACAATTCTGCTATATGCATGCCTGCAATGTGCACAGGACACCCTTGTACTTTTTTTGATAAAGGTAGCTATTTACTGAAAAAAAAA[A/T,AT]
GACCTATTTGGTTAGGGTCATGTCACAGTAGAGTGCCTAGCTGGCGCATAATTATGTCTGATAAAAAAAAGGGTTTCATATATGTCTTTTGGTAACACTT

Reverse complement sequence

AAGTGTTACCAAAAGACATATATGAAACCCTTTTTTTTATCAGACATAATTATGCGCCAGCTAGGCACTCTACTGTGACATGACCCTAACCAAATAGGTC[T/A,AT]
TTTTTTTTTCAGTAAATAGCTACCTTTATCAAAAAAAGTACAAGGGTGTCCTGTGCACATTGCAGGCATGCATATAGCAGAATTGTGTAATATCTCAACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 23.20% 0.08% 0.00% AT: 0.06%
All Indica  2759 90.50% 9.40% 0.07% 0.00% AT: 0.04%
All Japonica  1512 46.00% 53.90% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 91.20% 8.80% 0.00% 0.00% NA
Indica III  913 82.70% 17.10% 0.22% 0.00% NA
Indica Intermediate  786 93.40% 6.50% 0.00% 0.00% AT: 0.13%
Temperate Japonica  767 8.60% 91.30% 0.13% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 59.80% 40.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 72.20% 24.40% 1.11% 0.00% AT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726399988 A -> AT LOC_Os07g44180.1 upstream_gene_variant ; 3685.0bp to feature; MODIFIER silent_mutation Average:65.549; most accessible tissue: Callus, score: 89.016 N N N N
vg0726399988 A -> AT LOC_Os07g44160.1 downstream_gene_variant ; 3132.0bp to feature; MODIFIER silent_mutation Average:65.549; most accessible tissue: Callus, score: 89.016 N N N N
vg0726399988 A -> AT LOC_Os07g44170.1 downstream_gene_variant ; 377.0bp to feature; MODIFIER silent_mutation Average:65.549; most accessible tissue: Callus, score: 89.016 N N N N
vg0726399988 A -> AT LOC_Os07g44170-LOC_Os07g44180 intergenic_region ; MODIFIER silent_mutation Average:65.549; most accessible tissue: Callus, score: 89.016 N N N N
vg0726399988 A -> T LOC_Os07g44180.1 upstream_gene_variant ; 3686.0bp to feature; MODIFIER silent_mutation Average:65.549; most accessible tissue: Callus, score: 89.016 N N N N
vg0726399988 A -> T LOC_Os07g44160.1 downstream_gene_variant ; 3131.0bp to feature; MODIFIER silent_mutation Average:65.549; most accessible tissue: Callus, score: 89.016 N N N N
vg0726399988 A -> T LOC_Os07g44170.1 downstream_gene_variant ; 376.0bp to feature; MODIFIER silent_mutation Average:65.549; most accessible tissue: Callus, score: 89.016 N N N N
vg0726399988 A -> T LOC_Os07g44170-LOC_Os07g44180 intergenic_region ; MODIFIER silent_mutation Average:65.549; most accessible tissue: Callus, score: 89.016 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0726399988 A AT -0.22 -0.06 -0.03 -0.06 -0.08 0.1
vg0726399988 A T -0.01 -0.03 -0.03 -0.03 -0.06 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726399988 NA 1.01E-09 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 2.09E-16 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 7.35E-11 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 1.68E-16 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 8.40E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 4.41E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 2.34E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 1.97E-20 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 2.72E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 7.17E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 6.16E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 3.03E-08 1.28E-19 mr1853 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 9.68E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 8.10E-18 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 1.06E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 8.55E-08 2.79E-11 mr1676_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 4.70E-15 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988 NA 5.00E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251