\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726274862:

Variant ID: vg0726274862 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26274862
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTATAAGCTAAGTTGATTATATTTTTCTCTCTTTTTTTTTCTCTCATTATGAATTTAATATAAATATTTTAAAGCATGTGTAAACCTAATTTTTTATA[A/T]
GAGTCAGCACTTCTCATTTTTCTTTATCCCTTTCACATGAGTTTATAGTTGGTTTCTATCGATACGTATGCATCGATGCAACAAGAGACCAGGCAGCACA

Reverse complement sequence

TGTGCTGCCTGGTCTCTTGTTGCATCGATGCATACGTATCGATAGAAACCAACTATAAACTCATGTGAAAGGGATAAAGAAAAATGAGAAGTGCTGACTC[T/A]
TATAAAAAATTAGGTTTACACATGCTTTAAAATATTTATATTAAATTCATAATGAGAGAAAAAAAAAGAGAGAAAAATATAATCAACTTAGCTTATAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 21.50% 2.58% 25.10% NA
All Indica  2759 51.90% 1.40% 4.24% 42.37% NA
All Japonica  1512 46.60% 53.00% 0.26% 0.20% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 77.00% 2.40% 4.37% 16.30% NA
Indica II  465 34.40% 0.40% 4.52% 60.65% NA
Indica III  913 39.90% 0.40% 4.27% 55.42% NA
Indica Intermediate  786 57.40% 2.50% 3.94% 36.13% NA
Temperate Japonica  767 81.00% 18.50% 0.26% 0.26% NA
Tropical Japonica  504 4.20% 95.60% 0.20% 0.00% NA
Japonica Intermediate  241 25.70% 73.40% 0.41% 0.41% NA
VI/Aromatic  96 5.20% 92.70% 0.00% 2.08% NA
Intermediate  90 44.40% 41.10% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726274862 A -> DEL N N silent_mutation Average:63.828; most accessible tissue: Minghui63 root, score: 85.77 N N N N
vg0726274862 A -> T LOC_Os07g43960.1 downstream_gene_variant ; 1920.0bp to feature; MODIFIER silent_mutation Average:63.828; most accessible tissue: Minghui63 root, score: 85.77 N N N N
vg0726274862 A -> T LOC_Os07g43960.2 downstream_gene_variant ; 1920.0bp to feature; MODIFIER silent_mutation Average:63.828; most accessible tissue: Minghui63 root, score: 85.77 N N N N
vg0726274862 A -> T LOC_Os07g43960-LOC_Os07g43970 intergenic_region ; MODIFIER silent_mutation Average:63.828; most accessible tissue: Minghui63 root, score: 85.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726274862 NA 1.71E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 2.45E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 6.79E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 3.57E-07 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 7.88E-17 mr1330 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 1.43E-11 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 3.60E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 1.69E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 9.65E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 1.63E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 1.09E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 1.91E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 8.46E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 8.76E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 7.07E-15 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 2.34E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 3.05E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 9.77E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 1.43E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 3.23E-14 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 5.84E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 9.34E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726274862 NA 1.57E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251