Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0726257978:

Variant ID: vg0726257978 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26257978
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGTGAAACACAAATCGAAGAACTCTCAAAGTAGATGACAACTTTATTGCTTCTATCCGTGTTTACAAAGTGCACCAACAGCACTCCTTACAAAAATCT[C/T]
GACTAAACTCGAAACCCTAACTAAACTAGCTCTCAAAAGCTATACAAAAGCGATACAAAGCGATACCGGGAAGACTCATGCTCCCCCTCTATTTATACAT

Reverse complement sequence

ATGTATAAATAGAGGGGGAGCATGAGTCTTCCCGGTATCGCTTTGTATCGCTTTTGTATAGCTTTTGAGAGCTAGTTTAGTTAGGGTTTCGAGTTTAGTC[G/A]
AGATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGTAAACACGGATAGAAGCAATAAAGTTGTCATCTACTTTGAGAGTTCTTCGATTTGTGTTTCACCAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.60%	41.40%	1.02%	0.00%	NA
All Indica	2759	91.50%	7.00%	1.52%	0.00%	NA
All Japonica	1512	1.40%	98.60%	0.00%	0.00%	NA
Aus	269	56.50%	42.80%	0.74%	0.00%	NA
Indica I	595	89.20%	8.10%	2.69%	0.00%	NA
Indica II	465	91.40%	6.90%	1.72%	0.00%	NA
Indica III	913	94.50%	4.90%	0.55%	0.00%	NA
Indica Intermediate	786	89.70%	8.70%	1.65%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	1.60%	98.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	95.80%	1.04%	0.00%	NA
Intermediate	90	25.60%	71.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726257978	C -> T	LOC_Os07g43910.1	upstream_gene_variant ; 3507.0bp to feature; MODIFIER	silent_mutation	Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646	N	N	N	N
vg0726257978	C -> T	LOC_Os07g43940.1	downstream_gene_variant ; 1229.0bp to feature; MODIFIER	silent_mutation	Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646	N	N	N	N
vg0726257978	C -> T	LOC_Os07g43940.2	downstream_gene_variant ; 1229.0bp to feature; MODIFIER	silent_mutation	Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646	N	N	N	N
vg0726257978	C -> T	LOC_Os07g43925.1	intron_variant ; MODIFIER	silent_mutation	Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726257978	6.67E-06	NA	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726257978	1.84E-06	NA	mr1215	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726257978	7.79E-07	NA	mr1215	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726257978	4.19E-06	NA	mr1327	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726257978	NA	7.20E-06	mr1371	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251