\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726257978:

Variant ID: vg0726257978 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26257978
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGTGAAACACAAATCGAAGAACTCTCAAAGTAGATGACAACTTTATTGCTTCTATCCGTGTTTACAAAGTGCACCAACAGCACTCCTTACAAAAATCT[C/T]
GACTAAACTCGAAACCCTAACTAAACTAGCTCTCAAAAGCTATACAAAAGCGATACAAAGCGATACCGGGAAGACTCATGCTCCCCCTCTATTTATACAT

Reverse complement sequence

ATGTATAAATAGAGGGGGAGCATGAGTCTTCCCGGTATCGCTTTGTATCGCTTTTGTATAGCTTTTGAGAGCTAGTTTAGTTAGGGTTTCGAGTTTAGTC[G/A]
AGATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGTAAACACGGATAGAAGCAATAAAGTTGTCATCTACTTTGAGAGTTCTTCGATTTGTGTTTCACCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 41.40% 1.02% 0.00% NA
All Indica  2759 91.50% 7.00% 1.52% 0.00% NA
All Japonica  1512 1.40% 98.60% 0.00% 0.00% NA
Aus  269 56.50% 42.80% 0.74% 0.00% NA
Indica I  595 89.20% 8.10% 2.69% 0.00% NA
Indica II  465 91.40% 6.90% 1.72% 0.00% NA
Indica III  913 94.50% 4.90% 0.55% 0.00% NA
Indica Intermediate  786 89.70% 8.70% 1.65% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 1.04% 0.00% NA
Intermediate  90 25.60% 71.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726257978 C -> T LOC_Os07g43910.1 upstream_gene_variant ; 3507.0bp to feature; MODIFIER silent_mutation Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646 N N N N
vg0726257978 C -> T LOC_Os07g43940.1 downstream_gene_variant ; 1229.0bp to feature; MODIFIER silent_mutation Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646 N N N N
vg0726257978 C -> T LOC_Os07g43940.2 downstream_gene_variant ; 1229.0bp to feature; MODIFIER silent_mutation Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646 N N N N
vg0726257978 C -> T LOC_Os07g43925.1 intron_variant ; MODIFIER silent_mutation Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726257978 6.67E-06 NA mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726257978 1.84E-06 NA mr1215 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726257978 7.79E-07 NA mr1215 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726257978 4.19E-06 NA mr1327 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726257978 NA 7.20E-06 mr1371 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251