\
| Variant ID: vg0726257978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26257978 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 281. )
CTGGTGAAACACAAATCGAAGAACTCTCAAAGTAGATGACAACTTTATTGCTTCTATCCGTGTTTACAAAGTGCACCAACAGCACTCCTTACAAAAATCT[C/T]
GACTAAACTCGAAACCCTAACTAAACTAGCTCTCAAAAGCTATACAAAAGCGATACAAAGCGATACCGGGAAGACTCATGCTCCCCCTCTATTTATACAT
ATGTATAAATAGAGGGGGAGCATGAGTCTTCCCGGTATCGCTTTGTATCGCTTTTGTATAGCTTTTGAGAGCTAGTTTAGTTAGGGTTTCGAGTTTAGTC[G/A]
AGATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGTAAACACGGATAGAAGCAATAAAGTTGTCATCTACTTTGAGAGTTCTTCGATTTGTGTTTCACCAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.60% | 41.40% | 1.02% | 0.00% | NA |
| All Indica | 2759 | 91.50% | 7.00% | 1.52% | 0.00% | NA |
| All Japonica | 1512 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 56.50% | 42.80% | 0.74% | 0.00% | NA |
| Indica I | 595 | 89.20% | 8.10% | 2.69% | 0.00% | NA |
| Indica II | 465 | 91.40% | 6.90% | 1.72% | 0.00% | NA |
| Indica III | 913 | 94.50% | 4.90% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 8.70% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 95.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 25.60% | 71.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726257978 | C -> T | LOC_Os07g43910.1 | upstream_gene_variant ; 3507.0bp to feature; MODIFIER | silent_mutation | Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646 | N | N | N | N |
| vg0726257978 | C -> T | LOC_Os07g43940.1 | downstream_gene_variant ; 1229.0bp to feature; MODIFIER | silent_mutation | Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646 | N | N | N | N |
| vg0726257978 | C -> T | LOC_Os07g43940.2 | downstream_gene_variant ; 1229.0bp to feature; MODIFIER | silent_mutation | Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646 | N | N | N | N |
| vg0726257978 | C -> T | LOC_Os07g43925.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.441; most accessible tissue: Zhenshan97 flower, score: 85.646 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726257978 | 6.67E-06 | NA | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726257978 | 1.84E-06 | NA | mr1215 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726257978 | 7.79E-07 | NA | mr1215 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726257978 | 4.19E-06 | NA | mr1327 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726257978 | NA | 7.20E-06 | mr1371 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |