\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726196326:

Variant ID: vg0726196326 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26196326
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGAAGGCCCATGCATCGAAGCACAACAGTCGACAAAGGAGGTCTAAGTGTTCAATAATTCAAGGAGGGTAATTGCAGCAATTAGGATTGGGGCCGGCA[G/A]
GCTATCTCGCAAGCCGCGGCCGAAATACTTGTGTTAAACCTATTCATGCAATATTTGCGAAAAAGAAATACTTAGATTTAAATTATAGGTGCAAGATGAT

Reverse complement sequence

ATCATCTTGCACCTATAATTTAAATCTAAGTATTTCTTTTTCGCAAATATTGCATGAATAGGTTTAACACAAGTATTTCGGCCGCGGCTTGCGAGATAGC[C/T]
TGCCGGCCCCAATCCTAATTGCTGCAATTACCCTCCTTGAATTATTGAACACTTAGACCTCCTTTGTCGACTGTTGTGCTTCGATGCATGGGCCTTCGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 13.70% 0.11% 0.00% NA
All Indica  2759 83.40% 16.60% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 29.40% 68.80% 1.86% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 71.50% 28.50% 0.00% 0.00% NA
Indica Intermediate  786 81.80% 18.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726196326 G -> A LOC_Os07g43780.1 downstream_gene_variant ; 1583.0bp to feature; MODIFIER silent_mutation Average:38.676; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0726196326 G -> A LOC_Os07g43790.1 downstream_gene_variant ; 3396.0bp to feature; MODIFIER silent_mutation Average:38.676; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0726196326 G -> A LOC_Os07g43770-LOC_Os07g43780 intergenic_region ; MODIFIER silent_mutation Average:38.676; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726196326 NA 7.47E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726196326 NA 1.46E-06 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726196326 NA 3.52E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726196326 NA 5.89E-07 mr1168_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726196326 NA 1.89E-06 mr1400_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726196326 NA 4.55E-07 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251