\
| Variant ID: vg0726196326 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26196326 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 277. )
CCCGAAGGCCCATGCATCGAAGCACAACAGTCGACAAAGGAGGTCTAAGTGTTCAATAATTCAAGGAGGGTAATTGCAGCAATTAGGATTGGGGCCGGCA[G/A]
GCTATCTCGCAAGCCGCGGCCGAAATACTTGTGTTAAACCTATTCATGCAATATTTGCGAAAAAGAAATACTTAGATTTAAATTATAGGTGCAAGATGAT
ATCATCTTGCACCTATAATTTAAATCTAAGTATTTCTTTTTCGCAAATATTGCATGAATAGGTTTAACACAAGTATTTCGGCCGCGGCTTGCGAGATAGC[C/T]
TGCCGGCCCCAATCCTAATTGCTGCAATTACCCTCCTTGAATTATTGAACACTTAGACCTCCTTTGTCGACTGTTGTGCTTCGATGCATGGGCCTTCGGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.20% | 13.70% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 83.40% | 16.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.40% | 68.80% | 1.86% | 0.00% | NA |
| Indica I | 595 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 71.50% | 28.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726196326 | G -> A | LOC_Os07g43780.1 | downstream_gene_variant ; 1583.0bp to feature; MODIFIER | silent_mutation | Average:38.676; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 | N | N | N | N |
| vg0726196326 | G -> A | LOC_Os07g43790.1 | downstream_gene_variant ; 3396.0bp to feature; MODIFIER | silent_mutation | Average:38.676; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 | N | N | N | N |
| vg0726196326 | G -> A | LOC_Os07g43770-LOC_Os07g43780 | intergenic_region ; MODIFIER | silent_mutation | Average:38.676; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726196326 | NA | 7.47E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726196326 | NA | 1.46E-06 | mr1088_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726196326 | NA | 3.52E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726196326 | NA | 5.89E-07 | mr1168_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726196326 | NA | 1.89E-06 | mr1400_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726196326 | NA | 4.55E-07 | mr1620_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |