\
| Variant ID: vg0726131769 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26131769 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )
TGCATCGGTGTTCGATCTCCGGCTAAGGGGTAAGTCCAATGTTCCGCCGGCCCAGGCGATTGTCTCATCTACATCGACGTCGTTCAAGGCTGCATCAGTA[C/T]
ATTCGACCTCTTGGATTGCTCTGGTTTGGATGATATATTTGCCTACCTATTTATCATATGTCTCTGTTAATCTAGTCTTAGCATATCAATTTAGCTCTAT
ATAGAGCTAAATTGATATGCTAAGACTAGATTAACAGAGACATATGATAAATAGGTAGGCAAATATATCATCCAAACCAGAGCAATCCAAGAGGTCGAAT[G/A]
TACTGATGCAGCCTTGAACGACGTCGATGTAGATGAGACAATCGCCTGGGCCGGCGGAACATTGGACTTACCCCTTAGCCGGAGATCGAACACCGATGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 8.40% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 87.50% | 12.30% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 79.60% | 20.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.80% | 6.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 78.20% | 21.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 86.10% | 13.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726131769 | C -> T | LOC_Os07g43650.1 | upstream_gene_variant ; 1434.0bp to feature; MODIFIER | silent_mutation | Average:30.774; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| vg0726131769 | C -> T | LOC_Os07g43640.1 | downstream_gene_variant ; 3465.0bp to feature; MODIFIER | silent_mutation | Average:30.774; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| vg0726131769 | C -> T | LOC_Os07g43640-LOC_Os07g43650 | intergenic_region ; MODIFIER | silent_mutation | Average:30.774; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726131769 | NA | 1.39E-06 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726131769 | NA | 1.76E-07 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726131769 | NA | 8.18E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726131769 | NA | 1.10E-07 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726131769 | 8.29E-08 | NA | mr1521_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726131769 | NA | 1.80E-06 | mr1620_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726131769 | 1.27E-06 | NA | mr1896_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |