\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726131769:

Variant ID: vg0726131769 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26131769
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


TGCATCGGTGTTCGATCTCCGGCTAAGGGGTAAGTCCAATGTTCCGCCGGCCCAGGCGATTGTCTCATCTACATCGACGTCGTTCAAGGCTGCATCAGTA[C/T]
ATTCGACCTCTTGGATTGCTCTGGTTTGGATGATATATTTGCCTACCTATTTATCATATGTCTCTGTTAATCTAGTCTTAGCATATCAATTTAGCTCTAT

Reverse complement sequence

ATAGAGCTAAATTGATATGCTAAGACTAGATTAACAGAGACATATGATAAATAGGTAGGCAAATATATCATCCAAACCAGAGCAATCCAAGAGGTCGAAT[G/A]
TACTGATGCAGCCTTGAACGACGTCGATGTAGATGAGACAATCGCCTGGGCCGGCGGAACATTGGACTTACCCCTTAGCCGGAGATCGAACACCGATGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 8.40% 0.17% 0.00% NA
All Indica  2759 87.50% 12.30% 0.22% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 79.60% 20.10% 0.37% 0.00% NA
Indica I  595 98.70% 1.20% 0.17% 0.00% NA
Indica II  465 93.80% 6.00% 0.22% 0.00% NA
Indica III  913 78.20% 21.50% 0.33% 0.00% NA
Indica Intermediate  786 86.10% 13.70% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726131769 C -> T LOC_Os07g43650.1 upstream_gene_variant ; 1434.0bp to feature; MODIFIER silent_mutation Average:30.774; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N
vg0726131769 C -> T LOC_Os07g43640.1 downstream_gene_variant ; 3465.0bp to feature; MODIFIER silent_mutation Average:30.774; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N
vg0726131769 C -> T LOC_Os07g43640-LOC_Os07g43650 intergenic_region ; MODIFIER silent_mutation Average:30.774; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726131769 NA 1.39E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726131769 NA 1.76E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726131769 NA 8.18E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726131769 NA 1.10E-07 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726131769 8.29E-08 NA mr1521_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726131769 NA 1.80E-06 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726131769 1.27E-06 NA mr1896_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251