\
| Variant ID: vg0726127290 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26127290 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 107. )
TTTTTAAAAAGATATTTAAACCTCTCTTCTATTTTTTTTAAAAAATAATCCATTCTCAAGATGTCTAGTTTCTTTGGGTCTGTGTATTATATTTATTTGG[G/A]
TGATCCAAATAAGAAGATGATAATAATTCGTTTTTGATGCATGCGTCAGTGGTAGTCGTGTCTTGAGTACTTTGTAATGAAAATTTTGTTATCTCTCAAT
ATTGAGAGATAACAAAATTTTCATTACAAAGTACTCAAGACACGACTACCACTGACGCATGCATCAAAAACGAATTATTATCATCTTCTTATTTGGATCA[C/T]
CCAAATAAATATAATACACAGACCCAAAGAAACTAGACATCTTGAGAATGGATTATTTTTTAAAAAAAATAGAAGAGAGGTTTAAATATCTTTTTAAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.20% | 40.60% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 31.30% | 68.40% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 20.20% | 79.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 15.10% | 84.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 46.00% | 53.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 32.20% | 67.00% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726127290 | G -> A | LOC_Os07g43640.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.472; most accessible tissue: Callus, score: 64.184 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726127290 | NA | 2.84E-06 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726127290 | NA | 5.98E-33 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726127290 | NA | 8.72E-08 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726127290 | NA | 3.46E-08 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726127290 | NA | 1.19E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726127290 | NA | 2.38E-09 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726127290 | 2.54E-07 | NA | mr1246_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726127290 | NA | 4.39E-11 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726127290 | NA | 1.26E-12 | mr1409_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726127290 | NA | 1.03E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |