\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725674584:

Variant ID: vg0725674584 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25674584
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 359. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCTTTAGATTGCCACCTGCCACCCAGTGAGGCTGTGACAATGACACGGGGGGTCGATGACATATGGGCTAGGATGGAAAAACATCAAATTCCCAATCT[A/G]
AGAGTAGCAAATCATCAATTTTGGGATGAGGATTTAGGATATAGCAACTTGCAAGTATATAGGAGACAGGAAGTCCATGTCCAGCAAGTATCAGATGGGC

Reverse complement sequence

GCCCATCTGATACTTGCTGGACATGGACTTCCTGTCTCCTATATACTTGCAAGTTGCTATATCCTAAATCCTCATCCCAAAATTGATGATTTGCTACTCT[T/C]
AGATTGGGAATTTGATGTTTTTCCATCCTAGCCCATATGTCATCGACCCCCCGTGTCATTGTCACAGCCTCACTGGGTGGCAGGTGGCAATCTAAAGAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 19.20% 1.10% 0.08% NA
All Indica  2759 98.00% 1.50% 0.40% 0.11% NA
All Japonica  1512 43.20% 54.40% 2.38% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.30% 2.00% 0.67% 0.00% NA
Indica II  465 95.50% 4.10% 0.22% 0.22% NA
Indica III  913 99.80% 0.00% 0.11% 0.11% NA
Indica Intermediate  786 97.80% 1.40% 0.64% 0.13% NA
Temperate Japonica  767 78.00% 20.10% 1.83% 0.13% NA
Tropical Japonica  504 2.20% 96.20% 1.59% 0.00% NA
Japonica Intermediate  241 18.30% 75.90% 5.81% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 64.40% 30.00% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725674584 A -> DEL N N silent_mutation Average:72.878; most accessible tissue: Zhenshan97 root, score: 91.345 N N N N
vg0725674584 A -> G LOC_Os07g42890.1 upstream_gene_variant ; 3298.0bp to feature; MODIFIER silent_mutation Average:72.878; most accessible tissue: Zhenshan97 root, score: 91.345 N N N N
vg0725674584 A -> G LOC_Os07g42890.2 upstream_gene_variant ; 3211.0bp to feature; MODIFIER silent_mutation Average:72.878; most accessible tissue: Zhenshan97 root, score: 91.345 N N N N
vg0725674584 A -> G LOC_Os07g42880.1 downstream_gene_variant ; 509.0bp to feature; MODIFIER silent_mutation Average:72.878; most accessible tissue: Zhenshan97 root, score: 91.345 N N N N
vg0725674584 A -> G LOC_Os07g42885.1 downstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:72.878; most accessible tissue: Zhenshan97 root, score: 91.345 N N N N
vg0725674584 A -> G LOC_Os07g42880-LOC_Os07g42885 intergenic_region ; MODIFIER silent_mutation Average:72.878; most accessible tissue: Zhenshan97 root, score: 91.345 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0725674584 A G 0.11 0.06 0.03 0.01 0.07 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725674584 3.75E-06 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0725674584 NA 1.88E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 4.74E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 2.68E-06 2.68E-06 mr1261 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 1.08E-12 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 2.16E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 6.68E-11 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 5.47E-09 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 5.55E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 1.98E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 2.06E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 1.09E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 1.33E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 1.57E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 3.65E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 9.21E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 1.50E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 4.37E-09 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 5.69E-07 mr1808 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 8.28E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 8.92E-07 mr1865 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 3.21E-06 3.19E-06 mr1954 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 2.18E-07 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 1.59E-06 3.87E-08 mr1982 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 2.01E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 3.60E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 2.58E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 3.34E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725674584 NA 8.68E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251