Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0725411074:

Variant ID: vg0725411074 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25411074
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGAATCTCTTATATATGTCTCAATTAATCAGTTATTTTCTTGAAACAACTAAATGCTCATTTTTTTTTATTTTTTTTTAGAGAAGGGTATTTTCTACC[T/C]
GGCCTCTATATCCAACCAGATATATACGGCCATTGAGATAGGAAACTTAGCCCCGCAAACAACCCAATCTGAAATTCGCTCCATAGGAGATTTGAATTCA

Reverse complement sequence

TGAATTCAAATCTCCTATGGAGCGAATTTCAGATTGGGTTGTTTGCGGGGCTAAGTTTCCTATCTCAATGGCCGTATATATCTGGTTGGATATAGAGGCC[A/G]
GGTAGAAAATACCCTTCTCTAAAAAAAAATAAAAAAAAATGAGCATTTAGTTGTTTCAAGAAAATAACTGATTAATTGAGACATATATAAGAGATTCTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.80%	20.20%	0.06%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.04%	0.00%	NA
All Japonica	1512	41.00%	58.90%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.50%	0.13%	0.00%	NA
Temperate Japonica	767	10.80%	89.00%	0.13%	0.00%	NA
Tropical Japonica	504	87.90%	12.10%	0.00%	0.00%	NA
Japonica Intermediate	241	39.00%	61.00%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725411074	T -> C	LOC_Os07g42450.1	downstream_gene_variant ; 2353.0bp to feature; MODIFIER	silent_mutation	Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187	N	N	N	N
vg0725411074	T -> C	LOC_Os07g42440.1	intron_variant ; MODIFIER	silent_mutation	Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187	N	N	N	N
vg0725411074	T -> C	LOC_Os07g42440.4	intron_variant ; MODIFIER	silent_mutation	Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187	N	N	N	N
vg0725411074	T -> C	LOC_Os07g42440.3	intron_variant ; MODIFIER	silent_mutation	Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187	N	N	N	N
vg0725411074	T -> C	LOC_Os07g42440.2	intron_variant ; MODIFIER	silent_mutation	Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725411074	9.26E-06	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0725411074	9.60E-07	4.84E-15	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	2.23E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	3.46E-06	4.40E-13	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	3.01E-06	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	4.80E-07	6.09E-16	mr1650	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	3.35E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	5.68E-11	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	2.12E-13	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	7.55E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	1.26E-11	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	1.04E-23	mr1805	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	3.35E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	3.68E-14	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	1.19E-11	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	3.01E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	3.72E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	2.07E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074	NA	6.21E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251