\
| Variant ID: vg0725411074 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 25411074 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 111. )
ATAGAATCTCTTATATATGTCTCAATTAATCAGTTATTTTCTTGAAACAACTAAATGCTCATTTTTTTTTATTTTTTTTTAGAGAAGGGTATTTTCTACC[T/C]
GGCCTCTATATCCAACCAGATATATACGGCCATTGAGATAGGAAACTTAGCCCCGCAAACAACCCAATCTGAAATTCGCTCCATAGGAGATTTGAATTCA
TGAATTCAAATCTCCTATGGAGCGAATTTCAGATTGGGTTGTTTGCGGGGCTAAGTTTCCTATCTCAATGGCCGTATATATCTGGTTGGATATAGAGGCC[A/G]
GGTAGAAAATACCCTTCTCTAAAAAAAAATAAAAAAAAATGAGCATTTAGTTGTTTCAAGAAAATAACTGATTAATTGAGACATATATAAGAGATTCTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.80% | 20.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 41.00% | 58.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 10.80% | 89.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 87.90% | 12.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 39.00% | 61.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0725411074 | T -> C | LOC_Os07g42450.1 | downstream_gene_variant ; 2353.0bp to feature; MODIFIER | silent_mutation | Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187 | N | N | N | N |
| vg0725411074 | T -> C | LOC_Os07g42440.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187 | N | N | N | N |
| vg0725411074 | T -> C | LOC_Os07g42440.4 | intron_variant ; MODIFIER | silent_mutation | Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187 | N | N | N | N |
| vg0725411074 | T -> C | LOC_Os07g42440.3 | intron_variant ; MODIFIER | silent_mutation | Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187 | N | N | N | N |
| vg0725411074 | T -> C | LOC_Os07g42440.2 | intron_variant ; MODIFIER | silent_mutation | Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0725411074 | 9.26E-06 | NA | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0725411074 | 9.60E-07 | 4.84E-15 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 2.23E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | 3.46E-06 | 4.40E-13 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 3.01E-06 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | 4.80E-07 | 6.09E-16 | mr1650 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 3.35E-06 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 5.68E-11 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 2.12E-13 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 7.55E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 1.26E-11 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 1.04E-23 | mr1805 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 3.35E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 3.68E-14 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 1.19E-11 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 3.01E-08 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 3.72E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 2.07E-07 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725411074 | NA | 6.21E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |