\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725411074:

Variant ID: vg0725411074 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25411074
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGAATCTCTTATATATGTCTCAATTAATCAGTTATTTTCTTGAAACAACTAAATGCTCATTTTTTTTTATTTTTTTTTAGAGAAGGGTATTTTCTACC[T/C]
GGCCTCTATATCCAACCAGATATATACGGCCATTGAGATAGGAAACTTAGCCCCGCAAACAACCCAATCTGAAATTCGCTCCATAGGAGATTTGAATTCA

Reverse complement sequence

TGAATTCAAATCTCCTATGGAGCGAATTTCAGATTGGGTTGTTTGCGGGGCTAAGTTTCCTATCTCAATGGCCGTATATATCTGGTTGGATATAGAGGCC[A/G]
GGTAGAAAATACCCTTCTCTAAAAAAAAATAAAAAAAAATGAGCATTTAGTTGTTTCAAGAAAATAACTGATTAATTGAGACATATATAAGAGATTCTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 20.20% 0.06% 0.00% NA
All Indica  2759 98.90% 1.10% 0.04% 0.00% NA
All Japonica  1512 41.00% 58.90% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.50% 0.13% 0.00% NA
Temperate Japonica  767 10.80% 89.00% 0.13% 0.00% NA
Tropical Japonica  504 87.90% 12.10% 0.00% 0.00% NA
Japonica Intermediate  241 39.00% 61.00% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725411074 T -> C LOC_Os07g42450.1 downstream_gene_variant ; 2353.0bp to feature; MODIFIER silent_mutation Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187 N N N N
vg0725411074 T -> C LOC_Os07g42440.1 intron_variant ; MODIFIER silent_mutation Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187 N N N N
vg0725411074 T -> C LOC_Os07g42440.4 intron_variant ; MODIFIER silent_mutation Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187 N N N N
vg0725411074 T -> C LOC_Os07g42440.3 intron_variant ; MODIFIER silent_mutation Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187 N N N N
vg0725411074 T -> C LOC_Os07g42440.2 intron_variant ; MODIFIER silent_mutation Average:57.219; most accessible tissue: Zhenshan97 flower, score: 81.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725411074 9.26E-06 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0725411074 9.60E-07 4.84E-15 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 2.23E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 3.46E-06 4.40E-13 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 3.01E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 4.80E-07 6.09E-16 mr1650 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 3.35E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 5.68E-11 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 2.12E-13 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 7.55E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 1.26E-11 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 1.04E-23 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 3.35E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 3.68E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 1.19E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 3.01E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 3.72E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 2.07E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725411074 NA 6.21E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251